Illustrated key for the identification of brachyuran zoeal stages (crustacea decapoda) in the plankton of peter the great bay (sea of japan)

... 1858 are found only in Possyet Bay (eastern Peter the Great Bay) Brachyuran larvae occur in Peter the Great Bay from April to November Zoea of each species represented in this key has been previously ... also for Paradorippe granulata Different zoeal stages of brachyuran crabs (age distinctions) are easily determined using the number of natatory seta...

Ngày tải lên: 25/08/2016, 22:35

... other SNP arrays, including earlier versions of the Affymetrix platform, Illumina arrays, or array comparative genomic (a) 2.5 Raw copy number Raw copy number 3.0 hybridization Any platform that ... Birdsuite platform [17] QuantiSNP [26] is an analytical tool for the analysis of copy number variation using whole genome SNP genotyping data It was originally developed...

Ngày tải lên: 09/08/2014, 20:20

... over the capital city and gained control of the government 38 Jim really takes after his father They look the same, they act the same - they even have the same laugh! 39 You thought I stole your ... went down to the beaches near Cape Canaveral to watch the space shuttle take off The launch was magnificent 37 There was a military coup d'etat in the tiny nation The military...

Ngày tải lên: 26/06/2015, 09:00

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as show...

Ngày tải lên: 08/03/2014, 05:20

... complex The data reported here show that the cytoplasmic C-terminus of SUR1 has a key role in channel function but is not absolutely required for complex assembly or trafficking Our data support aspects ... DISCUSSION In this study we report a comprehensive study in a mammalian cell line of the effects of deletion of the SUR1 C-terminus on assembl...

Ngày tải lên: 31/03/2014, 08:20

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

... convergence rates for the Tikhonov regularization of the problems of identifying the coefficient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.5) (0.6) and the ... VIETNAM ACADEMY OF SCIENCE AND TECHNOLOGY INSTITUTE OF MATHEMATICS TRẦN NHÂN TÂM QUYỀN Convergence Rates for the Tikhonov Regularization...

Ngày tải lên: 25/07/2014, 07:22

... we investigate the inverse problems of identifying the coefficient q in the Neumann problem for the elliptic equation −div(q∇u) = f in Ω, ∂u q = g on ∂Ω ∂n (0.1) (0.2) and the coefficient a in the ... methods The authors of these works used the output least-squares method with the Tikhonov regularization of the nonlinear ill-posed problems and obtained...

Ngày tải lên: 25/07/2014, 07:22

... substitutions may function as partial TCR agonists on the one hand and prevent unwanted immune reactivity on the other [32,33] This approach may thus provide an improved option for APL therapy The ... methods Peptides and altered peptide ligands Peptides were synthesised by solid phase peptide synthesis Purity and identity of the peptides were assessed by reverse pha...

Ngày tải lên: 09/08/2014, 10:20

... of all miR loci in the Ciona genome Altogether, miRTRAP generated an apparent false negative rate of approxi- mately 5% and a false discovery rate of approximately 19% To systematically compare ... endogenous human Argonautes and their miRNA partners in RNA silencing Proc Natl Acad Sci USA 2008, 105:7964-7969 33 Katayama S, Tomaru Y, Kasukawa T, Waki K, Nakanishi M, Nakamura M, Nis...

Ngày tải lên: 09/08/2014, 20:21

... skin A videomicroscopic analysis Arch Dermatol 1998, 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of ... clinical diagnosis Arch Dermatol 1995, 131:298-304 Saida T, Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J...

Ngày tải lên: 10/08/2014, 21:23

... showed the accumulation of Ca/Sb precipitates in the vacuoles of the stigma cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange ... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pis...

Ngày tải lên: 11/08/2014, 11:21