Performance Studies on a Downdraft Biomass Gasifier with Blends of Coconut Shell and Rubber Seed Shell as Feedstock
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...
Ngày tải lên: 23/11/2012, 15:04
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx
... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...
Ngày tải lên: 23/03/2014, 17:22
báo cáo hóa học:" Research Article On a Nonlinear Integral Equation with Contractive Perturbation" pdf
... funzioni misurabilli,” Bollettino della Unione Matematica Italiana B, vol 3, no 6, pp 497–515, 1984 16 J Bana´ and Z Knap, “Measures of weak noncompactness and nonlinear integral equations of s convolution ... functional integral equation on an unbounded interval,” Nonlinear Analysis Theory, Methods & Applications, vol 71, no 9, pp 4131–4136, 2009 11 B Ricceri and A Villani, “Se...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Class of Homogeneous Kernels" pptx
... Inequalities & c c c Applications, vol 8, no 1, pp 28–51, 2005 11 B Yang, On the norm of a Hilbert’s type linear operator and applications,” Journal of Mathematical Analysis and Applications, vol 325, ... theory of operators, we define a new Hilbert-type operator and obtain its norm As applications, an extended basic theorem on Hilbert-type inequalities with the decreasi...
Ngày tải lên: 22/06/2014, 02:20
Báo cáo hóa học: " Research Article On a Hilbert-Type Operator with a Symmetric Homogeneous Kernel of −1-Order and Applications" doc
... Bulletin of the Belgian Mathematical Society, vol 13, no 4, pp 577–584, 2006 [3] B Yang, On the norm of an integral operator and applications,” Journal of Mathematical Analysis and Applications, ... Yang, “Generalization of a Hilbert-type inequality with the best constant factor and its applications,” Journal of Mathematical Research and Exposition, vol 25, no 2,...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo y học: "Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report" docx
... this article as: Antoniadou et al.: Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report Journal of Medical ... Structural changes, such as tonsilar hypertrophy, retrognathia, macroglossia, adenoid tissue and variations in craniofacial features, promote the occurrence...
Ngày tải lên: 11/08/2014, 03:21
Báo cáo y học: " Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report" doc
... this article as: Antoniadou et al.: Effect of continuous positive airway pressure therapy on a large hemangioma complicated with obstructive sleep apnea syndrome: a case report Journal of Medical ... Structural changes, such as tonsilar hypertrophy, retrognathia, macroglossia, adenoid tissue and variations in craniofacial features, promote the occurrenc...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo sinh học: " Optimum truncation points for independent culling level selection on a multivariate normal distribution, with an application to dairy cattle selection" pot
... unsatisfactory (Ducrocq and Colleau, 1986) Then alternative methods may have to be used (e.g., Russell et al., 1985) An application in the dairy cattle context Assumptions Dairy cattle selection is ... optimal situation may correspond to virtually no selection on type (weights 5:1) or to a culling on type evaluation of between a quarter and a half of the cand...
Ngày tải lên: 14/08/2014, 19:23
Genetic studies on a soil streptomyces sp that produces an antifungal compoud
... to a variety of fungal, bacterial, protozoal and viral diseases Species of Candida, Coccidioides, Histoplasma, and Aspergillus are important causative agents Of these, Candida species, especially ... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate...
Ngày tải lên: 07/10/2015, 10:02
Indentation studies on a zr based bulk metallic glass
... anneal the metallic glass To investigate the effect of quasi-static deformation on nanocrystallization behaviour in the shear bands, they conducted nanoindentation experiments on metallic glass Zr5 2.5Cu17.9Ni14.6Al10Ti5 ... 2.6.3 Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to cha...
Ngày tải lên: 09/10/2015, 11:24
On a fractional differential inclusion with integral boundary conditions in Banach space
... C Castaing, L X Truong, Second order differential conclusions with m-point boundary conditions, J Nonlinear Convex Anal to appear [6] C Castaing, P Raynaud de Fitte and M Valadier, Young measures ... functional differential equations of arbitrary orders, Nonlinear Anal 33 (1998), 181-186 [11] A M A El-Sayed, Sh A Abd El-Salam, Nonlocal boundary value problem of a fractiona...
Ngày tải lên: 26/10/2015, 14:00
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT ... changes that characterize prostate cancer progression Cancer Res 2001, 61:2212-2219 Sakakura C, Hagiwara A, Yasuoka R, Fujita Y, Nakanishi M, Masuda K, Shimomura K, Nakamura Y, Ina...
Ngày tải lên: 18/06/2014, 19:20
o cáo hóa học:" Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor " potx
... invasion, metastasis, and prognosis Lung Cancer 2002, 36:115-124 doi:10.1186/1479-5876-9-100 Cite this article as: Lo Iacono et al.: Aurora Kinase A expression is associated with lung cancer histological-subtypes ... data interpretation and drafted the manuscript MP and GVS participated in study design and coordination, data analysis and interpretation and...
Ngày tải lên: 20/06/2014, 04:20