The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt

... which are more thermolabile than is the DNA The characterization of the heat stability of the infectious activity of the > dg DNA preparation should therefore determine whether the DNA or some ... on the basis of the protein assay of Lowry et al (1951) and less than or equal to 0·001 on the basis of sulfur content Furthermore, from the equality of the act...

Ngày tải lên: 28/05/2016, 11:25

... presence of the MinE deletion mutants 144 Cellular location of Gfp-MinD in the presence of increasing levels of MinE-M and MinE1-33-M 145 Localization of MinE deletion mutants in the presence of MinD ... With the aim of gaining a better understanding of the roles ATP and MinE play in the reversible association of the Min proteins with the membrane, we explo...

Ngày tải lên: 13/11/2014, 10:02

... with the amino group and the N3 atom of the cytosine (Fig 1) This study uses site-directed mutagenesis to further explore the contribution of these amino acids interacting with the pyrimidine ring ... consisting of three domains, the CORE, the LID and the NMPbind [1] A characteristic of bacterial CMP kinases is an extension of the NMPbind domain by 40...

Ngày tải lên: 16/03/2014, 10:20

Ngày tải lên: 07/08/2014, 17:22

... evaluate the effects of ionic strength and Mg2+ on the activity and specificity of OGG1, we measured the apparent values of k2 and k3 under conditions of low salt (KPi only) and no Mg2+, low salt and ... Effects of ionic strength and divalent cations on the activity and specificity of Fpg and OGG1 The conditions inside a living cell differ from...

Ngày tải lên: 18/02/2014, 18:20

... The role of the C-terminal domain on Hfq (Eur J Biochem 271) 1259 the model further confirmed by determination of the X-ray structure of Staphylococcus aureus and E coli Hfq proteins [19,20] Hfq ... binding of the polyadenylated rpsO RNA We have shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of...

Ngày tải lên: 19/02/2014, 12:20

... with the sequences of 1CEV and 1RLA and pasted into the structural alignment The alignment was then corrected by hand Since the sequences of the two arginases and agmatinase greately differ in the ... that the environment of tryptophan residues is essentially conserved in the mutant enzyme On the other hand, the absence of major differences in the CD...

Ngày tải lên: 21/02/2014, 01:21

... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter ... protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP...

Ngày tải lên: 06/03/2014, 01:20

... helix of the third cluster of CHCs is part of the inter-domain segment and the other helix lines the boundary between the major domain and the N-terminus (Fig 1) Therefore, the formation of the ... rather than functional role Role of hydrophobic contacts in serine hydroxymethyltransferase In the present study, the importance of the third hydrop...

Ngày tải lên: 07/03/2014, 03:20

... 1996) In conclusion, our data demonstrate alarmingly high individual and multiple resistance to antibiotics in E coli, reflecting the misuse of these agents in the poultry industry Since chicken ... Clinical Laboratory Standards (NCCLS 1993) In addition, E coli organisms isolated from chicken and Table Comparison of pattern of resistance of E coli isola...

Ngày tải lên: 08/03/2014, 09:20

... half of them The present structure of monomeric E coli DnaG- C identifies the earlier crystal structure of the same protein as a domain- swapped dimer, in which helix of one monomer binds to the ... and of P16 (Fig 1) Helices 5002 Fig Stereo views of the solution and crystal structures of DnaG- C (A) Superposition of the backbone atoms of residues 447...

Ngày tải lên: 16/03/2014, 12:20

... hypothesis The demonstration of the IIACrr MalK interaction suggests that IIACrr may regulate the function of some of the > 140 MalK homologues found in the S coelicolor genome The one with the ... investigate is whether the mechanism of inducer exclusion is realized in S coelicolor Our observation that IIACrr could replace the inducer exclusion...

Ngày tải lên: 17/03/2014, 23:20

... intensity of the GlnB band was quantied as the sum of the concentrations of GlnB and GlnK and was denoted by PII* Note that PII* includes the modied forms of GlnB and GlnK as well, i.e GlnBUMP and ... bars indicate the SEM The dotted line is a result of two linear regression ts of the data points The extra abscissa on top of the gure indicates...

Ngày tải lên: 23/03/2014, 04:21

... small compared with those of G270V, E406G, and R166G Changes at the surface of the protein not appear to be major contributors to the solubility of the AMPP fragments The AMPP protein appears to have ... recombinant E coli AMPP and its domain variants Creating a library for truncated AMPP fragments The 1.3 kb pepP gene encoding E coli AMPP was PCR amp...

Ngày tải lên: 23/03/2014, 07:20

... there is no interaction between CIII and r32 From these results, we suggest that the inhibition of r32 by CIII is due to a direct CIII HflB interaction Results In vitro proteolysis of r32 by HflB ... CIIIC on the proteolysis of r32 by HflB was also assayed in the presence of CIIIC (60 lm) instead of CIII (Fig 2B) It is clear that in this A B...

Ngày tải lên: 23/03/2014, 10:20