The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt
The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt
... which are more thermolabile than is the DNA The characterization of the heat stability of the infectious activity of the > dg DNA preparation should therefore determine whether the DNA or some ... on the basis of the protein assay of Lowry et al (1951) and less than or equal to 0·001 on the basis of sulfur content Furthermore, from the equality of the activity and DNA distributions at the ... It follows from these results that DNA is the most thermolabile substance in the active material of the >'dg DNA preparation and further confirmation is given to the hypothesis that the proteins...
- 25
- 176
- 0
investigating the mechanism of escherichia coli min protein dynamics
... presence of the MinE deletion mutants 144 Cellular location of Gfp-MinD in the presence of increasing levels of MinE-M and MinE1-33-M 145 Localization of MinE deletion mutants in the presence of MinD ... With the aim of gaining a better understanding of the roles ATP and MinE play in the reversible association of the Min proteins with the membrane, we explored the interactions between the Min proteins ... regulating the 30 association and dissociation, respectively, of the Min proteins with the membrane To further characterize the role of MinE in Min protein dynamics, we investigated the contributions of...
- 238
- 104
- 0
Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf
... with the amino group and the N3 atom of the cytosine (Fig 1) This study uses site-directed mutagenesis to further explore the contribution of these amino acids interacting with the pyrimidine ring ... consisting of three domains, the CORE, the LID and the NMPbind [1] A characteristic of bacterial CMP kinases is an extension of the NMPbind domain by 40 amino acid residues forming a three-stranded ... NMPs (A37 and T39 in these enzymes are equivalent to S36 in E coli CMP kinase) Substitution of R110 with Met in E coli CMP kinase affected both kcat and Km The kcat Km ratio with CMP and dCMP decreased...
- 11
- 437
- 0
Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the specificity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf
... evaluate the effects of ionic strength and Mg2+ on the activity and specificity of OGG1, we measured the apparent values of k2 and k3 under conditions of low salt (KPi only) and no Mg2+, low salt and ... Effects of ionic strength and divalent cations on the activity and specificity of Fpg and OGG1 The conditions inside a living cell differ from most buffer systems in which the activity and specificity ... may be affected by ionic strength, the concentration of divalent cations such as Mg2+, the nature of the buffering agents, the presence of competing polyamines and other small molecules, and crowding...
- 14
- 567
- 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt
... The role of the C-terminal domain on Hfq (Eur J Biochem 271) 1259 the model further confirmed by determination of the X-ray structure of Staphylococcus aureus and E coli Hfq proteins [19,20] Hfq ... binding of the polyadenylated rpsO RNA We have shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of Hfq by 1.8 kcalÆmol)1 A comparison of the ... Figure shows the binding curves of Hfqf and Ó FEBS 2004 The role of the C-terminal domain on Hfq (Eur J Biochem 271) 1261 Fig Multiple sequence alignment of various bacterial Hfqs The alignment...
- 8
- 427
- 0
Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt
... with the sequences of 1CEV and 1RLA and pasted into the structural alignment The alignment was then corrected by hand Since the sequences of the two arginases and agmatinase greately differ in the ... that the environment of tryptophan residues is essentially conserved in the mutant enzyme On the other hand, the absence of major differences in the CD spectra of the wild-type and D153N agmatinases ... metal ligands are not substantially affected by the mutation, as revealed by the conservation of the whole topology of the active site, would explain the essentially unaltered interaction of the D153N...
- 5
- 475
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter ... protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP does affect the solubility, the solubility ... pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites...
- 11
- 445
- 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx
... helix of the third cluster of CHCs is part of the inter-domain segment and the other helix lines the boundary between the major domain and the N-terminus (Fig 1) Therefore, the formation of the ... rather than functional role Role of hydrophobic contacts in serine hydroxymethyltransferase In the present study, the importance of the third hydrophobic cluster as a structural determinant of ... Y55¢ interacts with the phosphate moiety of PLP; E57¢ is crucial in the binding of the l -serine hydroxyl group [15] and in the catalysis of the hydroxymethyltransferase reaction [16]; and Y65¢ interacts...
- 12
- 578
- 0
ANTIBIOTIC RESISTANCE OF ESCHERICHIA COLI ISOLATED FORM POULTRY WORKERS, PATIENTS AND CHICKEN IN THE EASTERN PROVINCE OF SAUDI ARABIA ppt
... 1996) In conclusion, our data demonstrate alarmingly high individual and multiple resistance to antibiotics in E coli, reflecting the misuse of these agents in the poultry industry Since chicken ... Clinical Laboratory Standards (NCCLS 1993) In addition, E coli organisms isolated from chicken and Table Comparison of pattern of resistance of E coli isolates from chicken and patients E coli- chicken ... from patients (Table 4) Discussion We investigated the resistance of E coli isolated from poultry industry workers and patients to antimicrobial agents commonly used in the poultry industry and/ or...
- 6
- 326
- 1
Báo cáo khoa học: Monomeric solution structure of the helicase-binding domain of Escherichia coli DnaG primase pdf
... half of them The present structure of monomeric E coli DnaG- C identifies the earlier crystal structure of the same protein as a domain- swapped dimer, in which helix of one monomer binds to the ... and of P16 (Fig 1) Helices 5002 Fig Stereo views of the solution and crystal structures of DnaG- C (A) Superposition of the backbone atoms of residues 447–581 of the 20 NMR conformers of DnaG- C ... (E) Conformer II of the crystal structure dimer of E coli DnaG- C [4] structure of DnaG- C as a domain- swapped dimer, where helix from one protein molecule binds to the core of the other in a manner...
- 13
- 245
- 0
Báo cáo Y học: The phosphotransferase system of Streptomyces coelicolor IIACrr exhibits properties that resemble transport and inducer exclusion function of enzyme IIAGlucose of Escherichia coli pptx
... hypothesis The demonstration of the IIACrr MalK interaction suggests that IIACrr may regulate the function of some of the > 140 MalK homologues found in the S coelicolor genome The one with the ... investigate is whether the mechanism of inducer exclusion is realized in S coelicolor Our observation that IIACrr could replace the inducer exclusion function of E coli IIAGlc by inhibition of maltose ... purification of S coelicolor IIACrr and IIACrr( H72A) To study the function of IIACrr, we overexpressed three crr alleles in E coli encoding His-tagged IIACrr, native IIACrr, and native IIACrr( H72A) Therefore,...
- 8
- 564
- 0
Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx
... intensity of the GlnB band was quantied as the sum of the concentrations of GlnB and GlnK and was denoted by PII* Note that PII* includes the modied forms of GlnB and GlnK as well, i.e GlnBUMP and ... bars indicate the SEM The dotted line is a result of two linear regression ts of the data points The extra abscissa on top of the gure indicates the molar ratio of PII*-trimer ATase-monomer The ... with the puzzle of a functional explanation for the existence of GlnB: why should control by PII* be absent altogether, and what then is the function of the cascade and of its pivot GlnB? The...
- 17
- 390
- 0
Báo cáo khoa học: Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P Implications for metal binding and protein stability pptx
... small compared with those of G270V, E406G, and R166G Changes at the surface of the protein not appear to be major contributors to the solubility of the AMPP fragments The AMPP protein appears to have ... recombinant E coli AMPP and its domain variants Creating a library for truncated AMPP fragments The 1.3 kb pepP gene encoding E coli AMPP was PCR amplified from plasmid pPL670 [2] using a forward primer ... ZnCl2 inhibits the activity of AMPP [1] Here, the presence of ZnCl2 in the dialysis buffer led to the precipitation of each of the three proteins Neither the intact protein nor the FEBS Journal...
- 10
- 538
- 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx
... there is no interaction between CIII and r32 From these results, we suggest that the inhibition of r32 by CIII is due to a direct CIII HflB interaction Results In vitro proteolysis of r32 by HflB ... CIIIC on the proteolysis of r32 by HflB was also assayed in the presence of CIIIC (60 lm) instead of CIII (Fig 2B) It is clear that in this A B C Fig ATP-dependence of proteolysis of r32 by HflB (Upper) ... because both are HflB substrates The relative binding affinity for r32 HflB interaction and CIII HflB interaction would play an important role in the inhibition of proteolysis of r32 by HflB Interestingly,...
- 6
- 453
- 0
Từ khóa: the implementation of international english withthe role of energy storage with renewable electricity generationthe branch of medicine concerned with diseases of the stomach and intestines isthe papyrus of ani dealt with what occurred in the afterlifethe ladder of love begins withthe position of object pronouns with command formsfind the standard form of the equation of a circle with endpoints of a diameterdetermine the standard form of the equation of a hyperbola with verticesuntil the end of time lyrics with beyoncesummarize the position of object pronouns with command formsfind the standard form of the equation of a circle with endpoints of a diameter at the pointsthe history of cell phones with picturestitration of potassium permanganate with oxalic acidredox titration of potassium permanganate with oxalic acidwhat are the types of computers networks with respect to geographical areaBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ