NearComplete Extinction of Native Small Mammal Fauna 25 Years After Forest Fragmentation
... number of small mammal species found on the mainland (Table S3) Fig S2 Mean small mammal species richness per transect in large (10.1-56.3 ha, n = 7) and small (0.3-4.7 ha, n = 9) islands 5-7 years ... version 2.12.2 (38) Fig S1 Rarefied small mammal species richness in large (10.1-56.3 ha, n = 7) and small (0.34.7 ha, n = 9) islands 5-7 years (dark tones) and 25- 26...
Ngày tải lên: 26/05/2016, 08:54
... Understanding the Internet Economy 12 The Global Internet Economy The U.S Internet Economy The European Internet Economy The Asian Internet Economy The Internet ... Estimating the Economic Benefits of the Commercial Internet The Internet Economy Helps Consumers The Internet Economy Helps Firms and Workers The Direct Contribution of the...
Ngày tải lên: 29/03/2014, 19:20
... polymerization of intact actin and aggregation of heated actin Interaction of HSP25 with intact actin Fig Effect of heating on the kinetics of polymerization (A) and saltinduced increase of the light ... sedimented Therefore, by measuring the quantity of actin in the pellet we were able to estimate the chaperone activity of HSP25 and its mutants In the a...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Characterization of native and recombinant A4 glyceraldehyde 3-phosphate dehydrogenase Kinetic evidence for conformation changes upon association with the small protein CP12 pptx
... for recombinant and native GAPDH with a multit using a common value of Km and different values of kcat The estimated parameters had a value of 25 lM for the Km, and the kcat for recombinant and ... those of native GAPDH The decrease of the catalytic constant is a fast process compared to the decrease of the K0.5 for BPGA These changes are...
Ngày tải lên: 23/03/2014, 20:22
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison
... groups of participants: Vietnamese learners of English and native speakers of English For the Vietnamese group, we contacted most of the Vietnamese participants in person and some via e-mail to ask ... (Journal of Japanese Language Teaching), 87, 25 - 39 Lauper, J A (1997) Refusal strategies of native English speakers in Spanish and in English...
Ngày tải lên: 07/09/2013, 13:31
Tài liệu Improving Reproductive Health through Community-Based Services: 25 Years of Pathfinder International Experience ppt
... L Improving Reproductive Health through Community-Based Services: 25 Years of Pathfinder International Experience Mary K Burket, MA Technical Communications Associate October 2006 Pathfinder. CBS ... greatest lesson learned in Pathfinder s 25 years of experience in community-based services, is that working at the community level is essential to improving...
Ngày tải lên: 13/02/2014, 15:20
Tài liệu Report of the Committee on Comprehensive Review of National Small Savings Fund doc
... objective of the minimisation of cost of borrowings of the Centre and the States on the other Further, the issue of the sharing of the cost of small savings collections has been an issue of contention ... Implementation of the Recommendations as a Package The Committee is of the view that the entire gamut of its recommendations on the ra...
Ngày tải lên: 16/02/2014, 10:20
Tài liệu An Assessment of the Small Business Innovation Research Program Project Methodology docx
... An Assessment of the Small Business Innovation Research Program Project Methodology Committee on Capitalizing on Science, Technology, and Innovation: An Assessment of the Small Business Innovation ... Innovation: An Assessment of the Small Business Innovation Research Program Proposal to the National Institutes of Health (Sample) I O...
Ngày tải lên: 17/02/2014, 06:20
Tài liệu Future Flight: A Review of the Small Aircraft Transportation System Concept pdf
... the Transportation Research Board (TRB) held a workshop at the request of the National Aeronautics and Space Administration (NASA) to examine its Small Aircraft Transportation System (SATS) concept ... ways to further the SATS concept and build acceptance by FAA, the broader GA community, and state and local transportation of cials NASA’s General Aviation Progra...
Ngày tải lên: 17/02/2014, 06:20
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCC...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khóa học: Some properties of human small heat shock protein Hsp20 (HspB6) potx
... of Hsp20, and both intact and Ó FEBS 2003 Human 20 kDa small heat shock protein (Eur J Biochem 271) 295 Fig Crosslinking of Hsp20 (A) Formation of disulfide crosslinked Hsp20 dimers A sample of ... plotted against the time of incubation Lack of precipitation of isolated small heat shock proteins is shown on curve 3D mutant of Hsp27 and wild-type Hsp20 (or...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khóa học: Chaperone activity of cytosolic small heat shock proteins from wheat pptx
... structure of cytosolic class II small heat shock proteins Plant Physiol 114, 1477–1485 Basha, E & Vierling, E (2003) Cloning and sequencing of a new cytosolic class II small heat shock protein from wheat ... molecular chaperone activity of plant recombinant small heat shock proteins Methods Enzymol 290, 350–365 Helm, K.W., LaFayette, P.R., Nagao, R.T.,...
Ngày tải lên: 07/03/2014, 15:20
financial management information systems 25 years of world bank docx
Ngày tải lên: 09/03/2014, 14:20
Báo cáo khoa học: Polysaccharide binding sites in hyaluronate lyase – crystal structures of native phage–encoded hyaluronate lyase and its complexes with ascorbic acid and lactose docx
... the structures of the native protein and its two complexes with ascorbic acid and lactose, we were able to obtain insight into the regions that are critical for ligand binding The substrate of ... Mishra et al Structures of hyaluronate lyase and its complexes Table Hydrogen bonded interactions between HylP2 and ascorbic acid at three binding regi...
Ngày tải lên: 23/03/2014, 04:21