Streptococcus pneumoniae Coinfection Is Correlated with the Severity of H1N1 Pandemic Influenza
... study First, S pneumoniae is important in the pathogenesis and prognosis of H1N1pdm-associated disease Whether this effect is associated with S pneumoniae sui generis or only with specific serotypes ... victims of H1N1pdm, the presence of S pneumoniae in NPS predicts severe disease outcome The risk associated with S pneumoniae is particularly prominent in 6-to-...
Ngày tải lên: 23/05/2016, 10:07
... reduce the development of experimental OA This study focuses on the in situ effect of licofelone on the gene expression and protein synthesis of the major collagenolytic enzymes (MMP-13 and cathepsin ... Treatment with licofelone at both concentrations reduced the levels of mRNA expression and protein synthesis of cathepsin K The...
Ngày tải lên: 09/08/2014, 06:23
... were associated with survival of severe sepsis when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C a...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo y học: "Relaxin''''s induction of metalloproteinases is associated with the loss of collagen and glycosaminoglycans in synovial joint" ppsx
... sites, including the pubic symphysis and synovial joints These findings also suggest that in fibrocartilaginous tissues, including the TMJ disc and possibly the pubic symphysis, relaxin decreases collagen ... of these proteinases to the changes in collagen and glycosaminoglycan (GAG) content in fibrocartilaginous disc explants Our findings are consistent with th...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: " A promoter SNP rs4073TA in the common allele of the interleukin 8 gene is associated with the development of idiopathic pulmonary fibrosis via the IL-8 protein enhancing mode" docx
... fluid and the alveolar macrophages of patients with IPF [9] An animal study also confirmed the role of IL -8 in pulmonary fibrosis by demonstrating that bleomycininduced lung fibrosis is attenuated ... evaluate the effect of the SNP on IL -8 gene or protein expression instead We measured IL -8 protein concentrations in the lung IL -8 protein was inc...
Ngày tải lên: 12/08/2014, 13:22
Báo cáo y học: " Inflammation-induced hepcidin-25 is associated with the development of anemia in septic patients: an observational study" pptx
... established in patients with an acute systemic inflammation Human sepsis is a prototypical acute inflammatory syndrome frequently complicated by the development of anemia As the incidence of sepsis ... cells, thereby preventing a loss of intracellular iron and the microcytic anemia that is seen in iron-deficiency anemia Therefore, inflammation -associated ane...
Ngày tải lên: 14/08/2014, 07:21
báo cáo khoa học: "Best linear unbiased prediction when error vector is correlated with other random vectors in the model" pptx
... Let the general linear model be S is assumed to be null, and R is taken to be Ia Another paper could the problem of estimation of S, R and G by either restricted maximum likelihood or minimum ... which are in this case V(K’13’) = K’P I I K for Alternative K’fi being equations to equations estimable (3.2) that not require the inverse of B are The disadvantage of these equations...
Ngày tải lên: 09/08/2014, 22:23
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine (ADMA) ... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of...
Ngày tải lên: 13/08/2014, 03:20
Tài liệu Báo cáo khoa học: Down-regulation of heme oxygenase-2 is associated with the increased expression of heme oxygenase-1 in human cell lines docx
... evaluation of heme dynamics in cultured cells Role of heme metabolism in cellular heme content Regulatory role of free heme in expression of HO-1 To evaluate the contribution of heme synthesis and ... HO-1 protein was also induced by the treatment with HO-2 siRNA in HepG2 cells These results indicate that the down-regulation of HO-2 expression is...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... than its interaction with PAP I Alternatively, it is also possible that PAP I stimulation of poly(A) synthesis is correlated with the ATPase activity of Hfq [25] 455 Hfq binding to RNA stimulates ... bound by Hfq It is possible that structural modifications resulting from Hfq binding facilitate recognition of the 3¢ end or its adenylation by PAP I...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Structure of Streptococcus agalactiae serine⁄threonine phosphatase The subdomain conformation is coupled to the binding of a third metal ion pptx
... lead to binding of a third metal ion The implications of the M3 binding and flap subdomain conformations to the catalytic mechanism are discussed below The role of the third metal in catalysis ... Goldman A (2006) Crystallization and preliminary crystallographic analysis of two Streptococcus agalactiae proteins: the family II inorganic pyrophosph...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: N-Methylation in polylegionaminic acid is associated with the phase-variable epitope of Legionella pneumophila serogroup 1 lipopolysaccharide pptx
... methylamino derivative of L-fucose in the LPS of Bordetella pertussis strain 14 14 [48,49], in which the N-methyl group gave a single singlet in the 1H NMR spectra Similarly, the minor pair of signals at ... and the loss of the mAb 2625 epitope is one of them Phase variation in L pneumophila was found to in uence other LPS biosynthesis pathways involved...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Interaction of G-rich GT oligonucleotides with nuclearassociated eEF1A is correlated with their antiproliferative effect in haematopoietic human cancer cell lines potx
... Length (-mer) 5¢-TGTTTGTTTGTTTGTTTGTTTGTTTGT-3¢ 5¢-TGGTGTGTGTGGGGTGGTTGGTG-3¢ 5¢-TGGGGTGTGTGGGGTGGTTGGTG-3¢ 5¢-TGGGGTGTGTGGGGGGGTTGGTG-3¢ 5¢-TGGTTGGGGTGGGGGGGGGGGTG-3¢ GT GT-G1 GT- G2 GT- G3 GT- G4 ... these results indicate that in haematopoietic cancer cells G-rich GT oligomers exert a growth inhibition effect by binding to nuclear-associated eEF1A protein and this effec...
Ngày tải lên: 16/03/2014, 13:20
Cancer Research UK’s strategy 2009–2014: Cancer Research UK’s aim is to reduce the number of deaths from cancer. Our future plans are ambitious, but they are in line with the challenge and the responsibility we face. docx
... with cancer, it is imperative that we accelerate our progress in tackling this terrible disease Our future aims are ambitious, but they are in line with the challenge and the responsibility we ... research into behavioural change relating to tobacco control and sun awareness - Increase our investment in symptom awareness and early diagnos...
Ngày tải lên: 22/03/2014, 16:21
báo cáo hóa học: " Low ficolin-3 levels in early follow-up serum samples are associated with the severity and unfavorable outcome of acute ischemic stroke" pptx
... Ficolin-3 and CRP levels in follow-up samples correlate with the outcome of acute ischemic stroke The levels of the ficolins and CRP were related to the outcome of the disease, as assessed by the modified ... distribution, and reproduction in any medium, provided the original work is properly cited 1 Low ficolin-3 levels in early f...
Ngày tải lên: 19/06/2014, 22:20