Somatostatin induced SSTR2A endocytosis is regulated through b arrestin2 arf6 EFA6A PLD1 cascade in panceratic b cells (RINm5F)

... hypothesis that SS -induced < /b> SSTR2A < /b> endocytosis < /b> is < /b> mediated by the β -arrestin2- Arf6- EFA6A- PLD1 cascade in cell model system Therefore, we proposed a novel mechanism regarding SSTR2A < /b> endocytosis < /b> pathway ... (2010) In this dissertation, I hypothesize that SS -induced < /b> SSTR2A < /b> endocytosis < /b> in β -cells is < /b> mediated...

Ngày tải lên: 22/05/2016, 16:56

... phosphorylase There is evidence that PP1-GM and PP1-GL may be regulated acutely by insulin Assay of PP1 following insulin infusion of skeletal muscle and immunopelleting of PP1-GM showed a 1. 5–2-fold increase ... TGA gacgaggcgcctgcggccgacggcggaaaacaccaaaggcacccgggggcggggcgacccgatgtggcggggaggagtag 920 I H F I * 279 9 21 gagagaccaggattggcgggagcggtccaagggagtc 957 Fig (...

Ngày tải lên: 30/03/2014, 16:20

... relatively low amount of cystatin F produced by U937 cells reported earlier [5] is an underestimate of the real production of cystatin F in U937 cells The high portion of intracellular cystatin F led ... production of cystatin F compared to the ubiquitous inhibitor, cystatin C, we measured the cystatin contents in cell lysates and culture media o...

Ngày tải lên: 21/02/2014, 01:21

... b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control Melting-curve ... against Ets-1 raised against its N-terminal region and an antibody against Elk-1 raised against phosphorylated Ser383 present at the C-terminus of this protein Preincubation of nuclear pr...

Ngày tải lên: 29/03/2014, 09:20

... inflammatory cytokines, resulting in maintaining the structure of the intervertebral disc Conclusions Intradiscal transplantation of synovial MSCs prevented intervertebral disc degeneration in vivo ... affected the remaining nucleus pulposus cells by inhibiting expressions of degradative enzymes and inflammatory cytokines, resulting in maintaining the structure...

Ngày tải lên: 12/08/2014, 15:22

... Identification of < /b> chromatin binding < /b> regions of < /b> LBR To analyze the < /b> binding < /b> of < /b> LBR to chromatin, we used the < /b> N-terminal portion of < /b> LBR, because this portion is responsible for the < /b> binding < /b> to chromatin [5,6] ... chromatin is stimulated by phosphorylation in the < /b> RS region of < /b> LBR by a ki...

Ngày tải lên: 22/02/2014, 04:20

... mechanistic insight into the regulation of Sirt1 protein in insulin- secreting b-cells brought about by mir-9 Sirt1 is down -regulated in insulin- secreting cells in a mir-9- dependent manner Discussion ... protein levels Interestingly, we observe that this control mechanism is relevant in insulin- secreting b-cells In order to gain more insight into the physiological...

Ngày tải lên: 06/03/2014, 00:21

... ylsuoiverp a ot gnidrocca dezisehtnys erew ]s)CTIR(2OiS@PNM ,ezis mn 05[ llehs acilis a nihtiw ,)ASU ,hcirdlA-amgiS ;CTIR( etanaycoihtosi B enimadohr ,eyd ecnecseroulf cinagro gniniatnoc selcitraponan ... ypocsorcim nortcele noissimsnart yb demrifnoc erew selcitrapoan citengam dezisehtnys ehT s)CTIR(2OiS@PNM ,elcitraponan citengam detaoc -acilis detaroprocni-CTIR mrof ot tsylatac a sa ainomma...

Ngày tải lên: 07/08/2014, 18:21

... mucin MUC4 by bile acids in oesophageal cancer cells is promoter-dependent and involves activation of the phosphatidylinositol 3-kinase signalling pathway Biochem J 2004, 377:701-708 Buisine MP, ... NF-kappaB via a Src-dependent Ras-MAPK-pp90rsk pathway is required for Pseudomonas aeruginosa -induced mucin overproduction in epithelial cells Proc Natl Acad Sci U S A 1998, 95...

Ngày tải lên: 12/08/2014, 16:20

... PPARc agonist -induced apoptosis [26,27] In the present study, we investigated PPARc agonist -induced adipocyte apoptosis by using 3T3-L1 adipocytes and rat primary adipocytes Adipocyte apoptosis could ... troglitazone -induced adipocyte apoptosis is probably mediated by PPARc, GW9662 should have an inhibitory effect on adipocyte apoptosis As shown in Fig 2B...

Ngày tải lên: 16/02/2014, 09:20

... in the case of hOR1D2, only in two out of four experiments Other olfactory receptors, such as mOR167-4, mOR199 -1, M 71, M72 and mOR2 41- 1 B C D E Fig The C-terminus of OR2AG1 interacts with MUPP1 ... (19 99) The organization of INAD -signaling complexes by a multivalent PDZ domain protein in Drosophila photoreceptor cells ensures sensitivity and speed of signaling Cell Ca...

Ngày tải lên: 18/02/2014, 13:20

... template requires prior binding of TFIIIB All individual mem- A Parthasarthy and K P Gopinathan Gly bers of the tRNA1 family from B mori analysed to date contain perfect TATAA sequences or AT-rich ... transcription A Parthasarthy and K P Gopinathan Fig Sequestration of transcription factors by tRNA1Gly -6,7 (A) Binding of TFIIIB alone (in the absence of TFIIIC)...

Ngày tải lên: 20/02/2014, 02:21

... well as NO production Accordingly, we concluded that the enhancing effect of TS on LPS/IFN -induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives ... amphiphilic structure of the polar carboxyl moiety and the hydrophobic isoprene moiety The enhancing effect of TS on LPS/IFN -induced NO production was inh...

Ngày tải lên: 22/02/2014, 04:20

... ubiquitination We have identified and characterized a signalling process involving Rac GTPase and a novel partner of activated Rac, the RING finger protein Unkempt, which binds to BAF60b and promotes ... this process takes place Indeed, although Rac activation is believed to occur primarily at the plasma membrane, BAF60b ubiquitination is controlled...

Ngày tải lên: 06/03/2014, 09:22

... beta-cells J Mol Biol 324 , 27 1 28 5 16 Zhang SP, Liu JX, Saafi EL & Cooper GJS (1999) Induction of apoptosis by human amylin in RINm5F 3790 17 18 19 20 21 22 23 24 25 26 27 28 29 islet beta-cells ... phosphorylation of ATF -2 in response to hA treatment is catalyzed mainly by p38 kinase We examined protein expression and phosphorylation of ATF -2 by p3...

Ngày tải lên: 07/03/2014, 12:20