Research Understanding Managerial Coaching The Role Of Manag

báo cáo khoa học: " Exploring the role of organizational policies and procedures in promoting research utilization in registered nurses" potx

... factors influencing the use of RBPs among staff nurses in the Canadian province of Newfoundland and Labrador with the specific aim of understanding the role of P&Ps in promoting research utilization ... understanding of the factors that influence nurses' use of RBPs, and the role that P&Ps may play in promoting research utilization in nurses...

Ngày tải lên : 11/08/2014, 05:22

11
417
0

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf

... determined and quantied To ll these gaps, residues Y3 31, R97 and E187 of Sfbgly50 were replaced through site-directed mutagenesis by phenylalanine (Y331F), methionine (R97M), lysine (R97K) and ... stability of the recombinant Sfbgly50 (n) was checked by incubating the enzyme in the same buers for an equal length of time and determining the remaining activity...

Ngày tải lên : 23/03/2014, 15:21

10
522
0

Báo cáo khoa học: " The role of marine salt and surfactants in the decline of Tyrrhenian coastal vegetation in Italy" ppt

... INTRODUCTION Since the early 1960s the vegetation in a number of coastal areas has been affected by a kind of decline which, in terms of both quality and intensity, is very different from the ... trees of P pinea, P tobira, Q ilex and A opalus growing When interpreting the results of the chemical analysis of rainwater and deposits it is necessary to bear...

Ngày tải lên : 08/08/2014, 19:21

11
371
0

Báo cáo y học: "A systematic review of the role of vitamin insufficiencies and supplementation in COPD" docx

... about the special role of any vitamin in COPD could not be obtained Vitamin D and COPD Vitamin D is extremely important for the human body It has a significant role in bone mineralization, in calcium ... COPD [106] Vitamin A and B Vitamin A (retinol and carotens) plays an important role in several functions of the human body including vision, bone and...

Ngày tải lên : 12/08/2014, 13:22

8
483
0

The role of cholesterol sequestration and accumulation in the endocytic pathway in development of neurodegenerative diseases

... biosynthesis pathway (Brown and Goldsein, 1980) In the biosynthetic secretory pathway, cholesterol concentration is lowest in the ER The ER is the primary site of cholesterol synthesis and esterification, ... which mediate the intercellular transport of sterols and other lipids, cannot pass the blood-brain barrier Nervous tissue is capable of cholesterol s...

Ngày tải lên : 14/09/2015, 14:06

129
417
0

Tài liệu Research " THE ROLE OF IMPORT SUBSITITUTION AND EXPORT ORIENTATION STRATEGIES ON THAILAND''''ECONOMIC GROWTH " ppt

Ngày tải lên : 18/02/2014, 11:20

98
414
0

The Role of Genetically Modified Organisms (GMOs) in Beverage Production

... throughout the world bears little resemblance to teosinte, the original ancestor of corn The newer techniques involving genetic engineering, on the other hand, allow for the transfer of a few genes in ... Finally, the food and beverage industries hope that the next generation of GM products will deliver compelling consumer beneÞts THE FUTURE OF GENETICALLY MODIF...

Ngày tải lên : 25/10/2013, 21:20

6
498
0

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...

Ngày tải lên : 18/02/2014, 11:20

15
635
0

Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

... helix of the third cluster of CHCs is part of the inter-domain segment and the other helix lines the boundary between the major domain and the N-terminus (Fig 1) Therefore, the formation of the ... rather than functional role Role of hydrophobic contacts in serine hydroxymethyltransferase In the present study, the importance of the third hydrop...

Ngày tải lên : 07/03/2014, 03:20

12
578
0

Báo cáo khoa học: The role of helix 8 and of the cytosolic C-termini in the internalization and signal transduction of B1 and B2 bradykinin receptors potx

... in Role of helix and C-termini in bradykinin receptors receptor signaling because: (a) interruption of the amphipathic structure of B1wt helix in B1wt and B1KB2 through the presence of a serine ... TSIfiAAA N3 38* B1wt B1RB2 B1NB2 B1CB2 B1KB2 B1KB2 ⁄ SfiV B1KB2 ⁄ QGVfiKQ B1KB2 ⁄ VCfiCV B1YB2 B1V323S 10400 5020 52 98 383 2 625 127 511 1701 182 3 17 58 2142 1 786...

Ngày tải lên : 07/03/2014, 16:20

12
595
0

The Peloponnesian War and the Future of Reference, Cataloging, and Scholarship in Research Libraries potx

... survey of Athenian financial history from the transfer of the Delian Treasury in, probably, 454 to the end of the Peloponnesian War some fifty years later, in the hope that future research will profit ... finding “something 26 quickly”–i.e., endorsing research having the lack of perspective exemplified by the Six Blind Men of India The objection that mai...

Ngày tải lên : 07/03/2014, 23:20

41
489
0

Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf

... raise the possibility that GSK3 may help to coordinate increases in glucose uptake and glycogen synthesis allowing for more effective ÔchannellingÕ of glucose into glycogen in response to insulin ... Effects of insulin, Li and SB-415286 on signalling elements implicated in the regulation of GSK3 and GS To further understand the effects of Li and...

Ngày tải lên : 08/03/2014, 08:20

10
804
0

Báo cáo Y học: Elucidation of the role of fructose 2,6-bisphosphate in the regulation of glucose fluxes in mice usingin vivo 13 C NMR measurements of hepatic carbohydrate metabolism docx

... of glycogen in the intact liver in vivo Second, during infusion of [1-1 3C ]glucose, label incorporation was observed not only into the C1 of glycogen but also the C6 , which can only occur by label ... a mechanism can lead to increases in labeling of glycogen C6 even in the presence of decreased activity of the indirect pathway, provided that the increas...

Ngày tải lên : 17/03/2014, 17:20

9
465
0

Báo cáo Y học: The role of hydrophobic active-site residues in substrate speciﬁcity and acyl transfer activity of penicillin acylase pdf

... phenylalanine was therefore mutated to Ala, Leu, Trp or Tyr These mutations may in uence the shape and volume of the acyl binding pocket and thereby alter the binding mode and afﬁnity of the enzyme ... PAA and derivatives thereof, while maintaining the hydrophobicity of the binding site To test the effect of the mutations on the speciﬁcity for phenylacet...

Ngày tải lên : 17/03/2014, 23:20

8
561
0

The role of floating-rate bank loans in institutional portfolios pdf

... not indicative of future results Russell Investments // Role of bank loans in a rising rate environment / p6 Bank loans in rising interest rate environments In the past 20 years (since 1992), there ... of St Louis, U.S Department of the Treasury Indexes are unmanaged and cannot be invested in directly Past performance is not indicative of future results Russell...

Ngày tải lên : 22/03/2014, 17:20

9
333
0

Research Understanding Managerial Coaching The Role Of Manager Attributes And Skills In Effective Coaching

báo cáo khoa học: " Exploring the role of organizational policies and procedures in promoting research utilization in registered nurses" potx

Báo cáo khoa học: The role of residues R97 and Y331 in modulating the pH optimum of an insect b-glycosidase of family 1 pdf