... BÌNH TRƯỜNG THPT YÊN MÔ A CÂU A ĐỀ KIỂM TRA TIẾT SỐ HỌC KỲ Môn Vật lý 11 Thời gian: 45 phút ĐÁP ÁN Nêu định luật ôm cho loại đoạn mạch a) Tính R để P = W Cường độ dòng điện qua R : I ĐIỂM 3 ... nút A I = I1 + I2 (1) * áp dụng định luật ôm cho A loại đoạn mạch: I1 I Vẽ hình 0,5 đ 0,5đ r1 R UBA = I.r - (2) I2 r2 UBA = - I.R (3) UBA = I.r - 21 (4) Giải hệ P...
Ngày tải lên: 23/07/2014, 13:21
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20
UNIT 1. ONLINE COMMUNITIES: A NEW OPPORTUNITY LESSON 3. KEY FACTORS FOR A SUCCESSFUL ONLINE COMMUNITYNOTE pptx
... Online Communities: a new opportunity - Key factors for a successful online community - page Organizational and environmental factors Key factors for a successful online community ORGANIZATIONAL AND ... Culture Online Communities: a new opportunity - Key factors for a successful online community - page Social and cultural factors Def...
Ngày tải lên: 08/03/2014, 20:20
Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx
... (2004) Physicochemical optimisation of plasmid delivery by cationic lipids J Gene Med 6, S24 S35 15 Wasungu L & Hoekstra D (2006) Cationic lipids, lipoplexes and intracellular delivery of genes ... diameter around lm Use of DOPE and cholesterol to enhance the genedelivery properties of cationic lipids has been extensively documented [1621] For 1,3lb2 and 1,3lb3, tr...
Ngày tải lên: 23/03/2014, 07:20
báo cáo khoa học: "Phase 1-2a multicenter dose-escalation study of ezatiostat hydrochloride liposomes for injection (Telintra®, TLK199), a novel glutathione analog prodrug in patients with myelodysplastic syndrome" doc
... phase 1- 2a study was the first clinical study of ezatiostat hydrochloride liposomes for injection in patients with all FAB classification types of MDS In phase 1, patients with MDS were administered ... for evaluation of ezatiostat in patients with MDS Pre-clinical data have shown that ezatiostat was well tolerated at single and repeated doses (...
Ngày tải lên: 10/08/2014, 22:20
Essential C# 3.0 FOR NET FRAMEWORK 3.5 PHẦN 1 docx
... 978-0-3 21- 35 017 -6 Paul Yao and David Durant, NET Compact Framework Programming with Visual Basic NET, 978-0-3 21- 17404-8 Mark Michaelis, Essential C# 3.0: For NET Framework 3.5, 978-0-3 21- 53392-0 For ... (~) 11 9 Control Flow Statements, Continued The while and do/while Loops The for loop 12 2 The foreach Loop 12 5 The switch Statement 12 8 Jump Statements 11...
Ngày tải lên: 12/08/2014, 16:21
Ô tô Camry 3.5Q - Phần 1 - P1
... BE-5 BODY ELECTRICAL – MULTIPLEX COMMUNICATION — REFERENCE — MPX communication uses serial communication ... communication that is used to represent information A bit is represented by binary values of “0” or 1 D A frame is a body of data that is transmitted together A frame contains a header that indicates
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P2
... TOYOTA models, * but is not used on the new Camry Communication Wire Outline Twisted-pair Wire for CAN 241BE168 Twisted-pair Wire for AVC-LAN 241BE168 AV Single Wire 240BE09 This communication ... communication *1: AVC-LAN is used in the audio-visual system on some other TOYOTA models, but is not used on the new Camry 2: The BEAN is used in the body electrical system of the previous Camr...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P3
... system *10 :Models with the pre-crush safety system *11 : Models with the Toyota parking assist system *12 :Models with the Toyota Link system BODY ELECTRICAL – MULTIPLEX COMMUNICATION BE -1 3 Diagnosis ... system *3: Models with the pre-crush safety system BE -1 1 BODY ELECTRICAL – MULTIPLEX COMMUNICATION " MS Bus A to/from CAN No .1 Bus Main Body ECU Seat ECU (for Driver) *1 Mirror Certif...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P4
... Roof*4 ,10 0 .15 sec 1. 0 sec / 0 .15 sec (Continued) BE -1 7 BODY ELECTRICAL – MULTIPLEX COMMUNICATION System Intelligent Tester II Display Content Contents Default Setting Available Setting +2_C / +1_ C ... OFF*4 Function to change the seat-belt warning buzzer D/P ON*7 D ON*8 Illuminated Entry Warning D / P ON / D ON / P ON / D / P OFF D/OFF ON*8 (Continued) BE BE -1 6 BODY ELECTRICAL – MU...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P6
... Australian and G.C.C G.C.C Countries Countries 2AZ-FE 2AZ-FE Engine Models Engine Models 0 .1/ 3.8 W — — / 21 W 0 .1 W — — 5W 21 W z 21 W z 16 W z 5W z 1. 0 W z *: Settings vary depending on the engine ... (see page MO-42) BE- 21 BODY ELECTRICAL – LIGHTING Rear Exterior Light High Mount Stop Light Taillight Taillight and Stop Light Rear Fog Light* Turn Signal Light License Plate Light...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P7
... is filled with xenon gas, and metal halide 240BE29 BE-24 BODY ELECTRICAL – LIGHTING Fail-Safe Function The light control ECU executes the fail-safe actions listed below in accordance with the problem ... BE-23 BODY ELECTRICAL – LIGHTING Layout of Main Components Power Distributor D Headlight Relay Light ... voltage that is input to the light control ECU deviates from the normal operating volt...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P8
... Level Control ECU Power Distributor D Headlight Relays Headlight Level Actuator 02KBE11TE Headlight Unit BE-28 BODY ELECTRICAL – LIGHTING Function of Main Components Components Function and Construction ... Power Distributor D Headlight Relays Headlight Level Actuator Headlight Unit 02KBE13TE BODY ELECTRICAL – LIGHTING BE- 31 Function of Main Components Component Outline D Calculates changes...
Ngày tải lên: 23/10/2012, 09:36
Ô tô Camry 3.5Q - Phần 1 - P9
... Engine ECU *1 Main Body ECU Brake Actuator D Skid Control ECU AFS OFF Switch Headlight Unit Cross Section Headlight Swivel Actuator *1: Models with 2GR-FE engine *2: Models with 1AZ-FE and 2AZ-FE engines ... Unit Left Right Right Turn 0_ Fixed 0_ to 10 _ to Right Left Turn 0_ to 15 _ to Left 0_ Fixed Medium-to-High Speed Control D The AFS ECU performs the medium-to-high speed control when...
Ngày tải lên: 23/10/2012, 09:36