A panel cointegration approach to estimating substitution elasticities in consumption monica auteri mauro costantini
Báo cáo khoa học: "A multi-staged approach to identifying complex events in textual data" ppt
... understood as relations (job title) or events (acquisitions) 3.3 Statistical training Because we had no existing methods to address financial events or relations, we took this opportunity to develop ... contextual information using text classification methods We also use text classification methods to help users to more quickly focus on an area where interesting transactions exist...
A systems-based approach to assessing leadership styles in engineers
... Text Mining Text mining is an “area within data mining that focuses on data from textual sources” (Feldman, 2003; Ye, 2003) Text mining is a large subfield of data mining It is an area that has developed ... research data are compared to the leadership skills needed that industry communicates in trade journals This comparison is determined using a subjective and approximate reasoning...
Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx
... the average capacity increase for allocating less or equal crosstalk cancellation taps than rs is set to zero, (ii) the average capacity increase for allocating more crosstalk cancellation taps ... the average capacity increases per allocated crosstalk cancellation tap For each of K tones the capacity increase has to be calculated for all N − crosstalk cancellation configurations...
báo cáo khoa học: " A modified TILLING approach to detect induced mutations in tetraploid and hexaploid wheat" pptx
... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA -AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA B A genome B genome D genome CCTCGATTTTATTTTCTAATGTTAT...
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx
... acknowledged that cell-cell interactions play a major role in tumorigenesis [18] Better understanding and estimating the nature of these interactions may play a key role for an early detection of cancer ... A, Iwasa Y: Possibility of tissue segregation caused by cell adhesion Journal of Theoretical Biology 2003, 221:459-474 Honda H, Yamanaka H, Eguchi G: Transformati...
Tài liệu A Public Health Approach to Children’s Mental Health - A Conceptual Framework pdf
... where a public health approach to children’s mental health can be envisioned and achieved viii A Public Health Approach to Children’s Mental Health: A Conceptual Framework Foreword In the fall ... mental health problems, treating mental health problems, and reclaiming optimal health while addressing a mental health problem A Public Hea...
Tài liệu A Client-Centered Approach to Reproductive Health: A Trainer’s Manual docx
... Tasneem and Tayyaba Gul were also an essential part of the core team during earlier trainings in Sargodha The manual was edited earlier by Mary D’Souza It was later transformed into the shape of a ... encourage those who may have had less advanced training to provide the needed skills to trainees 1.2 The manual s adaptability This Trainer’s Manual was originally developed for use...
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc
... the word order in target language To this end, we propose a simple but effective ranking-based approach to word reordering The ranking model is automatically derived from the word aligned ... baseline system for In order to show whether the improved performance is really due to improved reordering, we would like to measure the reorder performance directly 917 Reorder...
Tài liệu Báo cáo khoa học: "A Fully Bayesian Approach to Unsupervised Part-of-Speech Tagging∗" docx
... into Bayesian methods for other natural language learning tasks References M Banko and R Moore 2004 A study of unsupervised partof-speech tagging In Proceedings of COLING ’04 E Brill 1995 Unsupervised ... values of the latent variables are then taken to ˆ be those that maximize P (t|w, θ) In contrast, the Bayesian approach we advocate in this paper seeks to identify a distributi...
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx
... fsm feature, which indicates the state of a simple finite-state automaton that only has two states The automaton is set to initial state (q0) at the top of a message It makes a transition to state ... history for sequential learning in terms of previous messages Thus, for all three dimensions, we report results for histories defined within a single message in our evaluation below...
A logic-programming approach to network security analysis potx
... various information and tools together, yielding an end -to- end automatic system Attack graphs One purpose of network security analysis is to generate an attackgraph Roughly speaking, an attack ... suitable for network attack analysis Datalog is popular in deductive databases, and several decades of work in developing reasoning engines for databases has yielded tools that can eva...
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... server translates the information returned by the Sentinels into CycL and adds it to the KB This approach is potentially vulnerable to an attack on the Sentinels themselves, or to spoofing of their ... 95/98/NT/2000/XP, Linux RedHat and Solaris The Attack Planner enables the user to state plan goals, launch the planner and view the attack plans generated For exampl...
New directions Consumer goods companies hone a cross-channel approach to consumer marketing ppt
... new channels such as social media and mobile into the marketing mix to attract and engage consumers However, they are not ready to abandon traditional approaches to consumer marketing CG marketers ... New directions Consumer goods companies hone a cross-channel approach to consumer marketing Executive summary C onsumer goods (CG) manufacturers are aggre...
Báo cáo khoa học: "A Nonparametric Bayesian Approach to Acoustic Model Discovery" docx
... learned sub-word models to guide its hypotheses on phone boundaries Bayesian Model for Segmentation Our model is inspired by previous applications of nonparametric Bayesian models to segmentation ... used to represent 41 acoustic units Instead of discovering repetitive patterns first, our model is able to learn from any given data Unsupervised Speech Segmentation One goal...
Từ khóa: