Denoising of GPS structural monitoring observation error using wavelet analysis
Báo cáo sinh học: " Research Article Interactions between Uterine EMG at Different Sites Investigated Using Wavelet Analysis: Comparison of Pregnancy and Labor Contractions" pdf
... time-frequency plane between pregnancy and labor The values indicate also that during labor the location of the high synchronization becomes clearer and that there is more difference between values at the low ... values of CWCF range between (no amplitude correlation between X and Y) and (X and Y are totally correlated in amplitude) The application of these methods on EEG signals has indicated that phase ... comparison between CWCF and WLCC figures indicates that during pregnancy there is more phase correlation than during labor At the opposite, there is more amplitude correlation during labor than during pregnancy...
- 9
- 363
- 0
REAL-TIME MONITORING OF DISTRIBUTED REAL-TIME ANDEMBEDDED SYSTEMS USING WEB
... is real-time instrumentation and monitoring of DRE systems In this paper, we compared the performance of using AJAX and WebSockets to support real-time instrumentation and monitoring of DRE systems ... REAL-TIME MONITORING OF DISTRIBUTED REAL-TIME AND EMBEDDED SYSTEMS USING WEB A Thesis Submitted to the Faculty of Purdue University by Darshan Gajanan Puranik In Partial Fulfillment of the ... adding real-time monitoring support over the Web to the Open-source Architecture of Software Instrumentation of Systems (OASIS), which is open-source real-time instrumentation middleware for distributed...
- 65
- 351
- 0
Báo cáo y học: "Monte Carlo Commissioning of Low Energy Electron Radiotherapy Beams using NXEGS Software"
... photons and electrons in a variety of treatment modalities including intensity modulated radiotherapy (IMRT) and dynamic arc therapy The package includes, for both photons and electrons, commissioning ... regardless of the composition of commissioning sets, mean values of the seven confidence limits are typically less than %/mm over most of the range of depths and SSDs we examined, though quality of the ... simulate radiotherapy treatment units Med Phys 1995;22:503-24 Ma C-M, Faddegon BA, Rogers DWO, Mackie TR Accurate characterization of Monte Carlo calculated electron beams for radiotherapy Med Phys...
- 13
- 378
- 0
Effect of Process Parameters on the Degradation of Polychlorinated Biphenyls in Water Matrix using UV/H2O2
... determine the effects of initial H2O2 concentration, initial pH of the solution and initial PCB concentration on the degradation of PCBs in water matrix - 10 - Journal of Water and Environment ... adjusting the pH of the aqueous PCB solutions Effect of Initial PCB Concentration The results of the degradation of PCBs at different initial concentrations are shown in Figs and In all the initial ... pH of the samples and the temperature of the solution inside the photoreactor were continuously monitored The adjustment of the pH of the solution was done using 1.0N NaOH and 1.0N H2SO4 The effect...
- 9
- 582
- 0
Effect of biodiesel structural configuration on its ignition quality
... specify the ignition quality of any fuel The cetane number of esters of vegetable oils (Biodiesel) is greater than those of both vegetable oils and No diesel fuel [9] As indicator of ignition quality, ... Chemical Properties on Biodiesel Fuels on Injection, Combustion and Exhaust Emission Characteristics in a Direct Injection Compression Ignition Engine, International Journal of Engine Research, ... the discussions it may be concluded that the overall percentage of unsaturation or saturation may not be sole authority to decide cetane number of a biodiesel The contribution of long straight...
- 12
- 536
- 0
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... Ronnachai C, Piyarat B, Poonsuk P, Sumate C Effect of organic loading rate on methane and volatile fatty acids productions from anaerobic treatment of palm oil mill effluent in UASB and UFAF reactors ... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start-up ... Development of anaerobic migrating blanket reactor (AMBR), A novel anaerobic treatment system Wat Res 2001;35:1739-1747 [12] Leslia Grady CP, Kim H Biological Wastewater Treatment- Theory and Applications,...
- 8
- 408
- 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR conditions ... Primer sequence 5¢-Forward-3¢ 5¢-Reverse-3¢ CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA...
- 12
- 795
- 0
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... for interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in lectin signal pattern ... Nakaya S, Ito H, Sato T, Shikanai T, Takahashi Y, Takahashi K & Narimatsu H (2005) A strategy for identification of oligosaccharide structures using observational multistage mass spectral library...
- 11
- 854
- 0
Performance Evaluation of Active Suspension for Passenger Cars.Using MATLAB
... Performance Evaluation of Active Suspension for Passenger Cars Using MATLAB suspension can gave better performance of suspension by having force actuator, which is a ... College of Engineering, Pune, India 13 | Page Performance Evaluation of Active Suspension for Passenger Cars Using MATLAB VI CONCLUSION The methodology was developed to design an Active suspension for ... M.E.Society's College of Engineering, Pune, India 12 | Page Performance Evaluation of Active Suspension for Passenger Cars Using MATLAB The potential for improved ride comfort and better road...
- 9
- 592
- 3
Tài liệu Report of the Independent Monitoring Board of the Global Polio Eradication Initiative pptx
... extract from the polio dictionary Independent Monitoring Board of the Global Polio Eradication Initiative Every Missed Child INDEPENDENT MONITORING BOARD OF THE GLOBAL POLIO ERADICATION INITIATIVE ... bring eradication closer Independent Monitoring Board of the Global Polio Eradication Initiative Every Missed Child 11 It is clear to everyone associated with the Global Polio Eradication Initiative ... INITIATIVE June 2012 The Independent Monitoring Board was convened at the request of the World Health Assembly to monitor and guide the progress of the Global Polio Eradication Initiative s 2010-12...
- 44
- 281
- 1
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calcium binding site in this structural class of proteins ... between the enzymes conformational dynamics and active-site chemistry through domain motions [17,18,21,78] Conclusions In this article, we further demonstrate the value of chemical glycosylation as...
- 17
- 531
- 0
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
... shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic mock-up ... patient communication _ diagnostic mock-up I Fig 6 _Diagnostic mock-up (Case I) Fig 7_Intra-oral view of diagnostic mock-up (Case I) Fig help patients understand and visualise the expected aesthetic ... material (3M ESPE; Fig 5) and placed on lubricated teeth After setting of the material and removal Fig 19 Fig 18 _Diagnostic mock-up (Case III) Fig 19_Intra-oral view of diagnostic mock-up (Case...
- 5
- 378
- 0
Tài liệu Báo cáo khoa học: "Integration of Speech to Computer-Assisted Translation Using Finite-State Automata" pdf
... out -of- vocabulary (OOV) words The remaining part of the XEROX corpus is used to train a back off trigram language model using the SRI language modeling toolkit (Stolcke, 2002) The LM perplexity of ... Schaaf, u u and A Waibel 2005a Speech translation enhanced automatic speech recognition In Automatic Speech Recognition and Understanding Workshop (ASRU), pages 121–126, Puerto Rico, San Juan G Foster, ... model for an automatic text dictation system in the computer-assisted translation framework will be described In Section 3, the details of the machine translation system and the speech recognition...
- 8
- 438
- 0
Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx
... current approach, Asher and Lascarides (1999) take all connections (of both asserted and presupposed material) to be structural attachments through rhetorical relations The relevant rhetorical relation ... January Alistair Knott and Chris Mellish 1996 A featurebased account of the relations signalled by sentence and clause connectives Language and Speech, 39(2-3): 143-183 Alistair Knott 1996 A Data-driven ... Grote et al (1997), Jayez and Rossari (1998) and Lagerwerf (1998) Secondly, the approach demands an understanding of the attentional characteristics of presuppositions In particular, preliminary study...
- 8
- 415
- 0
Từ khóa: monitoring membrane voltage using two photon excitation of fluorescent voltage sensitive dyeshow neural networks find promoters using recognition of micro structural promoter componentsactivity artifact flow of gps ins integration for positioning error de correlationlist of families rights and responsibilities in using the social mediadesign of a candy vending machine controller using verilog hdllist of families rights and responsibilities in using social mediaon the mathematical properties of the structural similarity indexthe lord of the rings online game error 201day to day life of a structural engineerhow to make part of a picture black and white using photoshopexamples of web services in asp net using clist of projects in digital image processing using matlab538 design of a 4 to 16 decoder using 74x138s539 design of a 5 to 32 decoder using 74x138s and a 74x139—value of the resource additions and depletion of oil present discounted value method using 3 discount rateBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật