... time-frequency plane between pregnancy and labor The values indicate also that during labor the location of the high synchronization becomes clearer and that there is more difference between values at the low ... values of CWCF range between (no amplitude correlation between X and Y) and (X and Y are totally correlated in amplitude) The application of these meth...
Ngày tải lên: 21/06/2014, 16:20
... is real-time instrumentation and monitoring of DRE systems In this paper, we compared the performance of using AJAX and WebSockets to support real-time instrumentation and monitoring of DRE systems ... REAL-TIME MONITORING OF DISTRIBUTED REAL-TIME AND EMBEDDED SYSTEMS USING WEB A Thesis Submitted to the Faculty of Purdue University by Darshan Gajanan Pura...
Ngày tải lên: 24/08/2014, 12:08
Báo cáo y học: "Monte Carlo Commissioning of Low Energy Electron Radiotherapy Beams using NXEGS Software"
... photons and electrons in a variety of treatment modalities including intensity modulated radiotherapy (IMRT) and dynamic arc therapy The package includes, for both photons and electrons, commissioning ... regardless of the composition of commissioning sets, mean values of the seven confidence limits are typically less than %/mm over most of the range of depths and SSDs we ex...
Ngày tải lên: 03/11/2012, 10:05
Effect of Process Parameters on the Degradation of Polychlorinated Biphenyls in Water Matrix using UV/H2O2
... determine the effects of initial H2O2 concentration, initial pH of the solution and initial PCB concentration on the degradation of PCBs in water matrix - 10 - Journal of Water and Environment ... adjusting the pH of the aqueous PCB solutions Effect of Initial PCB Concentration The results of the degradation of PCBs at different initial concentrat...
Ngày tải lên: 05/09/2013, 09:08
Effect of biodiesel structural configuration on its ignition quality
... specify the ignition quality of any fuel The cetane number of esters of vegetable oils (Biodiesel) is greater than those of both vegetable oils and No diesel fuel [9] As indicator of ignition quality, ... Chemical Properties on Biodiesel Fuels on Injection, Combustion and Exhaust Emission Characteristics in a Direct Injection Compression Ignition Engine, International...
Ngày tải lên: 05/09/2013, 16:10
A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor
... Ronnachai C, Piyarat B, Poonsuk P, Sumate C Effect of organic loading rate on methane and volatile fatty acids productions from anaerobic treatment of palm oil mill effluent in UASB and UFAF reactors ... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu Báo cáo "Numerical simulations of overland floods in urban areas using a conservative Godunov-type scheme " pptx
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT CAAACCATGGAAGCTGTACG TTCTGTGCCTGGAATGATGCT GAGTGGAGTGGAAGGAGAAGGG CCTCTTGGTGTTGGTCTTTGC CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT Average efficiency ± SD Template Optimal PCR conditions Cocktail PCR...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: A strategy for discovery of cancer glyco-biomarkers in serum using newly developed technologies for glycoproteomics ppt
... for interaction proteomics Anal Chem 74, 4725–4733 Kagebayashi C, Yamaguchi I, Akinaga A, Kitano H, Yokoyama K, Satomura M, Kurosawa T, Watanabe M, Kawabata T, Chang W et al (2009) Automated ... Differential glycan profiling between cancer and normal cells enables identification of aberrant glycosylation in cancer [indicated as a red triangle in (B) and (C)] as an alteration in...
Ngày tải lên: 16/02/2014, 08:20
Performance Evaluation of Active Suspension for Passenger Cars.Using MATLAB
... Performance Evaluation of Active Suspension for Passenger Cars Using MATLAB suspension can gave better performance of suspension by having force actuator, which is a ... College of Engineering, Pune, India 13 | Page Performance Evaluation of Active Suspension for Passenger Cars Using MATLAB VI CONCLUSION The methodology was developed to design an Act...
Ngày tải lên: 16/02/2014, 09:13
Tài liệu Report of the Independent Monitoring Board of the Global Polio Eradication Initiative pptx
... extract from the polio dictionary Independent Monitoring Board of the Global Polio Eradication Initiative Every Missed Child INDEPENDENT MONITORING BOARD OF THE GLOBAL POLIO ERADICATION INITIATIVE ... bring eradication closer Independent Monitoring Board of the Global Polio Eradication Initiative Every Missed Child 11 It is clear to...
Ngày tải lên: 18/02/2014, 15:20
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calc...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx
... shape and alignment and declined the periodontal surgery It was explained that her central incisors would have a squared shape and would appear shorter and wider In her case, a diagnostic mock-up ... patient communication _ diagnostic mock-up I Fig 6 _Diagnostic mock-up (Case I) Fig 7_Intra-oral view of diagnostic mock-up (Case I) Fig help patients understand a...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: "Integration of Speech to Computer-Assisted Translation Using Finite-State Automata" pdf
... out -of- vocabulary (OOV) words The remaining part of the XEROX corpus is used to train a back off trigram language model using the SRI language modeling toolkit (Stolcke, 2002) The LM perplexity of ... Schaaf, u u and A Waibel 2005a Speech translation enhanced automatic speech recognition In Automatic Speech Recognition and Understanding Workshop (ASRU), pages 121–126, Puerto...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "Discourse Relations: A Structural and Presuppositional Account Using Lexicalised TAG*" docx
... current approach, Asher and Lascarides (1999) take all connections (of both asserted and presupposed material) to be structural attachments through rhetorical relations The relevant rhetorical relation ... January Alistair Knott and Chris Mellish 1996 A featurebased account of the relations signalled by sentence and clause connectives Language and Speech, 39(2-3): 143-183 Alis...
Ngày tải lên: 20/02/2014, 18:20