... functions and in growth analysis Some brief remarks on the income -education- ability interrelation conclude the comment I THE ROLE OF EDUCATION IN AGGREGATE PRODUCTION FUNCTIONS AND IN GROWTH ... through the latter parts of this paper as the discussion turns to the implications of the ability -education- income inter- relationships for the asse...
Ngày tải lên: 06/03/2014, 21:20
... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP...
Ngày tải lên: 07/03/2014, 03:20
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand...
Ngày tải lên: 22/03/2014, 18:20
báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot
... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...
Ngày tải lên: 11/08/2014, 11:21
An exploratory study on the role of emotions in service satisfaction and loyalty behaviours
... experiences In the past two decades, the interest in emotions and in their impact on satisfaction (and lately on loyalty) has led to the recognition of their significant role in satisfaction formation (see ... 2.5 Emotions in a service context 2.5.1 Emotional content of service During the 1980’s, the concept of hedonic consumption arose, acknowl...
Ngày tải lên: 28/09/2015, 13:28
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx
... processing approach to comprehension of French, w i l l form the basis of the discussion I t is the in interaction of the results of these asynchronous processes that the process of comprehension ... at any moment of the process are context dependent; they depend on the "current state" of the system The system presents an i n i t i a l attempt to integrate...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: "Last but Definitely not Least: On the Role of the Last Sentence in Automatic Polarity-Classification" pdf
... we examined the readers’ rating of the polarity of reviews in their entirety, while in the second experiment we examined the readers’ rating of the same reviews based on reading single sentences ... single sentences extracted from the same 16 reviews: the last sentence and the second sentence of each review The last and the second sentence of each...
Ngày tải lên: 23/03/2014, 16:20
essays on the role of unobservables in corporate strategy
... been instrumental in developing my interests in connecting theory and empirical work and has been a source of inspiration His PhD seminar on methodology remains one of my favorite classes in the ... predictions that are counter-intuitive Though extant literature, particularly within the domain of economics and industrial organization, has examined strategic interaction in...
Ngày tải lên: 02/11/2014, 00:33
updates on the role of broad spectrum penicillinsin the management of community acquired pneumonias
... Presentation ICID 2008 Choice of empirical therapy Selection of antibiotics would depend on Most likely pathogens The resistance patterns of these pathogens based on local data Other factors ... Dosing regimen should maximise the duration of time above MIC The unbound serum concentration of the antibiotic should be above the MIC for at least 40% to 50% of t...
Ngày tải lên: 01/12/2014, 14:58
A STUDY ON THE ROLE OF USING VIETNAMESE IN TEACHING ENGLISH VOCABULARY TO THE 10TH FORM ETHNIC MINORITY STUDENTS AT VUNG CAO VIET BAC HIGH SCHOOL -Nghiên cứu về vai trò của việc sử dụng Tiếng Việt trong dạy từ vựng Tiếng Anh cho học sinh dân
... have a reflection on their teaching practice The Aims of the Study The research is aimed to investigate the role of using Vietnamese in teaching vocabulary to the 10th form students at Vung cao ... (Nation, 2001) One of the greatest advantages of using learners‟ first language in vocabulary teaching is that it provides an easier...
Ngày tải lên: 30/03/2015, 14:00
Single molecule studies on the role of nucleoid associated proteins in bacterial chromatin
... SINGLE- MOLECULE STUDIES ON THE ROLE OF NUCLEOID- ASSOCIATED PROTEINS IN BACTERIAL CHROMATIN RICKSEN SURYA WINARDHI B.Sc.(Hons.), Nanyang Technological University A THESIS SUBMITTED FOR THE ... nucleoid- associated proteins in shaping the bacterial nucleoid and regulating the gene expression Despite wealth of knowledge on the function of these...
Ngày tải lên: 09/09/2015, 11:26
ON THE ROLE OF VOCAL EMOTIONS FOR VERBAL MEMORY
... of verbal information maintained in long-term memory In the following section, I will present their findings 4 Effects of speaker prosody on verbal memory Effects of emotional prosody on verbal ... indicate their level of confidence in this selection When the memory load was low, results for recognition memory paralleled that of the free recall memory in...
Ngày tải lên: 12/10/2015, 17:36
Are Innovating Firms Victims or Perpetrators? Tax Evasion, Bribe Payments, and the Role of External Finance in Developing Countries
... and taxes evaded, innovating firms and firms that use formal finance are more likely to be net victims The findings point to the challenges facing innovators in developing countries and the role ... lower than the cost of bribes would suggest On the other hand, the uneven incidence of bribes between innovating and non -innovating firms, and f...
Ngày tải lên: 21/04/2016, 07:15
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx
... Atlanta, GA 30333 SUGGESTED CITATION Centers for Disease Control and Prevention The role of BCG vaccine in the prevention and control of tuberculosis in the United States: a joint statement by ... Committee and the Advisory Committee for Elimination of Tuberculosis published a joint statement on the use of BCG va...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA GAACCTTTATTCGCTATTGGTACCGGTAAA GAACCTTTATTCGCTATTGGTACCGGTAAA TCACCGGTCCATGATCCATT NcoI KpnI KpnI HaeIII 4178 FEBS Journal 276 (2009) 41694183 ê 2009 The Authors ... maintain the unusual Ramachandran angles for the K12 residue, and a Ramachandran scatter plot for the K12 residues in 21 TIM structures from various sources (available f...
Ngày tải lên: 18/02/2014, 11:20