... 16 21 23 17 22 24 10 18 23 25 11 19 24 26 12 20 25 27 13 21 26 28 14 22 27 29 15 23 28 30 16 10 24 29 31 17 11 25 30 32 18 12 15 19 22 19 13 16 20 23 20 14 17 21 24 21 15 18 22 25 22 16 19 23 ... 29 21 27 29 36 30 22 28 30 37 31 23 29 32 38 32 24 30 33 39 n a b c q 33 25 31 34 40 34 15 22 26 41 35 16 23 27 42 36 17 24 28 43 37 1...
Ngày tải lên: 13/08/2014, 02:21
... 22 21 18 23 22 19 24 23 20 25 24 21 26 25 22 27 26 23 28 27 24 29 28 25 22 29 26 10 23 21 27 11 24 22 28 12 25 23 29 13 26 24 30 14 27 25 31 15 28 26 32 16 29 27 n Q L a 33 23 22 34 24 23 35 25 ... 25 24 36 26 25 37 27 26 38 28 27 39 29 28 40 22 29 41 23 22 42 10 24 23 43 11 25 24 44 12 26 25 45 13 27 26 46 14...
Ngày tải lên: 13/08/2014, 02:21
PHYSICS 3 (ELECTRICITY AND MAGNETISM) - CHAPTER 3 potx
... 100 30 0 85 n e r R C 33 30 100 30 0 20 34 32 150 450 25 35 34 200 600 30 36 36 250 750 35 37 38 30 0 900 40 38 40 100 30 0 45 39 42 150 450 50 40 44 200 600 55 41 46 250 750 60 42 48 30 0 900 65 43 ... 16 13 24 45 20 18 14 25 10 25 26 15 30 27 20 35 28 25 40 10 10 29 30 45 12 11 30 35 50 15 12 31 40 20 16 13 32 45 25 18 14 n e1 e2 r1 r2 R 33 10 20 34 15 25 35 2...
Ngày tải lên: 13/08/2014, 02:21
PHYSICS 3 (ELECTRICITY AND MAGNETISM) - CHAPTER 4 docx
... 11 40 39 26 13 12 45 40 28 14 13 50 41 30 15 14 55 42 32 16 15 60 10 43 34 17 16 65 11 44 36 18 17 70 12 45 38 19 18 75 13 46 42 21 19 80 14 47 44 22 20 85 15 48 46 23 21 90 16 n a b d I1 I2 49 ... 0.06 n 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 d 2.1 2.2 2 .3 2 .4 2.5 2.6 2.7 2.8 2.9 3. 1 3. 2 3. 3 3. 4 3. 5 3. 6 3. 7 v 9 B 0.07 0....
Ngày tải lên: 13/08/2014, 02:21
PHYSICS 3 (ELECTRICITY AND MAGNETISM) - CHAPTER 5 pps
... 32 48 30 30 33 49 31 31 34 50 32 32 35 51 33 n a b R 33 36 34 34 37 35 35 38 36 36 39 37 37 40 38 38 41 39 39 42 10 40 40 43 11 41 41 44 12 42 42 45 13 43 43 46 14 44 44 47 15 45 45 48 16 46 46 ... 47 50 18 48 48 51 19 49 n a b R 49 25 50 50 26 51 51 27 52 52 28 53 53 29 10 54 54 30 11 55 55 31 12 56 56 32 13 57 57 33 14 58 58 34...
Ngày tải lên: 13/08/2014, 02:21
PHYSICS 3 (ELECTRICITY AND MAGNETISM) - CHAPTER 6 ppt
... Electricity and Magnetism n R L C 64 49 50 51 52 53 54 55 150 150 150 150 150 150 150 10 20 40 60 80 100 30 30 30 30 30 30 30 56 150 120 30 57 150 150 30 58 150 175 30 59 150 200 30 60 150 225 30 61 150 ... 30 0 32 200 35 0 n R L C 33 50 20 34 50 10 20 35 50 20 20 36 50 40 20 37 50 60 20 38 50 80 20 43 50 200 20 44 50 225 20 45 50 250 20 46 50 275 20 47 50 30...
Ngày tải lên: 13/08/2014, 02:21
PHYSICS 3 (ELECTRICITY AND MAGNETISM) - CHAPTER 7 pps
... 150 35 0 Appendix I Factor 24 10 21 10 Prefix yottazetta- Symbol Prefix Symbol -2 4 yocto- y -2 1 zepto- z -1 8 atto- a -1 5 femto- f -1 2 pico- p -9 nano- n -6 micro- -3 milli- m -2 centi- c -1 Y ... 2.5 30 0 3. 5 400 450 4.5 500 10 550 11 5.5 600 12 650 13 6.5 70 0 14 75 0 15 7. 5 800 16 850 22 4.5 200 23 250 24 5.5 30 0 25 35 0 26 6.5 400 27 450 28...
Ngày tải lên: 13/08/2014, 02:21
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... by information about the participants The study implementation is outlined along with information about data collection instruments used Finally, details of the nature of the data this study has ... is a reason why the Ministry of Education and Training needs to innovate the way of the second language teaching by applying the communicative approach in teachin...
Ngày tải lên: 07/09/2013, 13:02
Slide a study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... Department at MSA - Nature of group work - Relationship between group work and individual presentation Objectives of the study contribute more theory to the understandings of group discussion find ... Number of participants in a group: Number of groups: ( No planning groups & Pre-planning groups) Records: All the group discussions and the indiv...
Ngày tải lên: 29/01/2014, 10:33
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc
... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... protein A sepharose, separated by SDS ⁄ PAGE, and detected by fluorography (C) Autoradiograms similar to those shown in (B) were exposed to storage phosphor screen and quantifi...
Ngày tải lên: 18/02/2014, 16:20
Đề tài " Integrality of a ratio of Petersson norms and level-lowering congruences " pot
... Annals of Mathematics, 163 (2006), 901–967 Integrality of a ratio of Petersson norms and level-lowering congruences By Kartik Prasanna To Bidisha and Ananya Abstract We prove integrality of ... KARTIK PRASANNA Tata Institute and IIT Bombay who guided me in my initial steps: especially Nitin Nitsure, M S Raghunathan, A R Shastri, Balwant Singh, V Srinivas and...
Ngày tải lên: 06/03/2014, 08:21
Vật lý A level: Data and formulae booklet
... 2 w INSERT TO PHYA4/PHYA5 INSERT TO PHYA4/PHYA5 Turn over ᮣ INSERT TO PHYA4/PHYA5
Ngày tải lên: 12/03/2014, 16:26