... Access Design of a series visco-elastic actuator for multi-purpose rehabilitation haptic device Jakob Oblak*, Zlatko Matjačić Abstract Background: Variable structure parallel mechanisms, actuated ... significantly stabilizes haptic performance mechanism and actuators with series elasticity, stability and passivity of haptic performance can be obtained Because such...
Ngày tải lên: 19/06/2014, 08:20
... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of ... Results and discussion There are many design and operating parameters which affect the performance characteristics and distillate yield of...
Ngày tải lên: 05/09/2013, 16:11
Báo cáo hóa học: "Research Article A Cross-Layer Routing Design for Multi-Interface Wireless Mesh Networks" pptx
... F Akyildiz and X Wang, A survey on wireless mesh networks,” IEEE Communications Magazine, vol 43, no 9, pp 22–30, 2005 [3] A Adya, P Bahl, J Padhye, A Wolman, and L Zhou, A multiradio unification ... placed in a 500 m × 500 m area (Figure 7) The simulation parameters are the same as the uniform topology The throughputs are almost similar in these routing protocols at low traffic lo...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Emergency Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals In these hospitals, data were obtained ... A majority of hospitals in Australia and New Zealand (ANZ) appear to have introduced a Medical Emergency Team (MET) system • The introduction of such systems in...
Ngày tải lên: 25/10/2012, 10:35
Robust Cross-Layer Scheduling Design in Multi-user Multi-antenna Wireless Systems
... Robust Cross-Layer Scheduling Design in Multi-user Multi-antenna Wireless Systems by Meilong Jiang MSEE, Beijing University of Posts and Telecomms A thesis submitted in partial fulfillment ... Cross-Layer Scheduling and Adaptive Design in Multi-user Wireless Network 2.2.1 Adaptive Design in Physical Layer 2.2.2 MAC Layer Scheduling Model Linear ... goodp...
Ngày tải lên: 20/11/2012, 11:36
The Argument from Design - A Brief History
... His grandfather Erasmus Darwin put forward ideas sympathetic to the transmutation of species at the end of the eighteenth century, and the Frenchman Jean Baptiste de Lamarck did the same at the ... method is to state what the characters are that distinguish the animal – to explain what it is and what are its qualities – and to deal after the same fashion with its several par...
Ngày tải lên: 01/11/2013, 07:20
Tài liệu Design a impressive Album pdf
... the balance is the balance between occupied and empty space As my father said “the page should have some air to breathe” Leave space around the photographs in such a way that the photograph(s) ... create a dynamic tension, which adds variety to the album (and general appeal) But don't make it too dramatic and don't make too many unbalanced pages – it should be the spice, not the dish An...
Ngày tải lên: 24/12/2013, 20:15
Tài liệu Mechatronic Experiments Course Design - A Myoelectric Controlled Partical-Hand Prosthesis Project ppt
... programming skills and interface circuit design abilities; 3) familiarize students with computer-aided design or computer-aided manufacture software packages, such as AutoCAD; 4) teach students about ... amplifiers, a bandpass filter is required to increase the signal-to-noise ratio and reject other physiological signals, such as the electrocardiogram (ECG) signal and axon action potent...
Ngày tải lên: 25/12/2013, 19:15
Tài liệu Mechatronic Experiments Course Design - A Myoelectric Controlled Partical-Hand Prosthesis Project docx
... programming skills and interface circuit design abilities; 3) familiarize students with computer-aided design or computer-aided manufacture software packages, such as AutoCAD; 4) teach students about ... amplifiers, a bandpass filter is required to increase the signal-to-noise ratio and reject other physiological signals, such as the electrocardiogram (ECG) signal and axon action potent...
Ngày tải lên: 19/01/2014, 20:20
Tài liệu Báo cáo khoa học: The plasminogen activator inhibitor 2 transcript is destabilized via a multi-component 3¢ UTR localized adenylate and uridylate-rich instability element in an analogous manner to cytokines and oncogenes pdf
... CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA ... CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC...
Ngày tải lên: 16/02/2014, 09:20