The synthesis of three dimensional haptic textures geometry, control, and psychophysics

... preparation of OMCs with different pore symmetries and tunable pore sizes According to a simplified model, we deduced the carbon pore size equation that is expected to direct the synthesis of OMCs with tunable ... h in air Synthesis of Ordered Mesoporous Carbons Ordered mesoporous carbon materials were synthesized using the recipe described previously [4, 12...

Ngày tải lên: 22/06/2014, 00:20

... represents the local topological status of the wireless ad hoc network To a certain extent, the node locations and their corresponding degrees would affect the configuration of the wireless ad hoc network ... from (3) and reflects the distribution of A in the Y − Z plane Thus, the problem in three-dimensional space can be reduced to the combination of...

Ngày tải lên: 22/06/2014, 22:20

... synthesize calcium carbonate 3D nanofibrous structures from eggshells using femtosecond laser processing To the best of authors’ knowledge, this is the first work on synthesizing 3D calcium carbonate nanofibrous ... Tavangar et al.: Synthesis of three-dimensional calcium carbonate nanofibrous structure from eggshell using femtosecond laser ablation...

Ngày tải lên: 11/08/2014, 00:22

... effect of strenuous fatigue on the control of upright standing posture [6-9] An interesting observation from the present results concerns the gradual Figure Attentional demands Attentional demands ... comparison between the no fatigue and fatigue conditions showed a significant effect of fatigue (F1,9 = 16.41, P < 0.01) The frequency of actions increased between the...

Ngày tải lên: 11/08/2014, 14:20

... used in the analysis The message in Figure 37 indicates that the analysis and design sections are different The goal is to repeat the analysis and design process until the analysis and design sections ... Click the Design menu > Steel Frame Design > Start Design/ Check of Structure command or the Start Steel Design/ Check of Structure button, to start the steel f...

Ngày tải lên: 06/09/2012, 15:56

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

... 45:1041–1053 Cox DK 1974 Effects of three heating rates on the critical thermal maximum of bluegill In Gibbons JW, Sharitz RR, eds, Thermal Ecology CONF-730505 National Technical Information Service, Springfield, ... presence of each of the chemicals Chemical concentrations used in the present study are presented in Table Measured values or recovery rates of test c...

Ngày tải lên: 14/03/2014, 20:20

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

... on the synthesis of porous ␣-Fe2 O3 nanorods have been published to date [46] Owing to their specific characteristics and promising applications exploring proper methods for the synthesis of nanoscale ... nanostructures The presence of a rod-like micelle of the surfactant in solution promoted the formation of one-dimensional rod-like structures Herein, we report...

Ngày tải lên: 19/03/2014, 16:48

... synthesis of novel materials and the development of new processes Solvothermal synthesis of novel materials Roy has described the challenge for synthesizing new materials to specification [32] Hydro- and ... Conclusion Solvothermal reactions appear to be important for either the synthesis of novel materials, the preparation of nanostructured particl...

Ngày tải lên: 20/03/2014, 13:08

... the SnO2 nanorods Fig The XRD pattern of the SnO2 nanorods grown via the hydrothermal method room temperature on a Horiba Jobin Yvon LabRam IR system at a spatial resolution of mm Raman scattering ... consist of nanorods as well as nanoparticles The diameters of SnO2 nanorods are in the range of 100–150 nm with lengths of the order of 1–2 mm The end planes...

Ngày tải lên: 20/03/2014, 13:08

... with the precursor to form metal–oxygen–metal groups (Scheme 2, Eq 2) The combination of these two equations leads to the elimination of R–X and H–X The other possibility is the elimination of ... Eq 3) The second possible mechanism is related to radicals involved in the reaction as a result of the bubble’s collapse Application of ultrasound to chemical p...

Ngày tải lên: 20/03/2014, 13:11

... monophosphate kinases L Wang supply of nucleoside monophosphates may regulate the synthesis of nucleoside di- and triphosphates In Mollicutes, other enzymes exist that are capable of synthesizing nucleoside ... purification of Ureaplasma nucleoside monophosphate kinases Primers used in PCR amplification of Ureaplasma nucleoside monophosphate kinases...

Ngày tải lên: 30/03/2014, 08:20

... element, a nonlinear shell element, and geometric nonlinearity Analysis capabilities include static nonlinear analysis for material and geometric effects, including pushover analysis; nonlinear time-history ... unmatched in terms of ease -of- use and productivity Creation and modification of the model, execution of the analysis, and checking and optimization o...

Ngày tải lên: 01/04/2014, 03:20

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26