Influenza virus

... anti -influenza virus antibodies Serum from subjects with past history of influenza virus vaccination or no infection was incubated with nitrocellulose strips containing influenza virus vaccine ... and elevated in adults and children vaccinated with Influenza virus Children with no history of either Influenza virus infection or vaccination had s...

Ngày tải lên: 25/10/2012, 11:10

...   Ivanovski and Beijerinck showed that a disease in tobacco was caused by a virus Loeffler and Frosch discovered an animal virus that causes foot –and-mouth disease in cattle Many years of ... viruses are exceptions to the rules re: DNA and RNA    Parvoviruses contain single-stranded DNA Reoviruses contain double-stranded RNA DNA Viruses  ssDNA  dsDNA   linear circular RN...

Ngày tải lên: 15/03/2014, 12:58

... was calculated by the method of Reed and Muench [40] Activation and inhibition of the Raf/MEK/ERK signal cascade Activation of the Raf/MEK/ERK signal cascade was achieved by artificial stimulation ... J: The viral polymerase mediates adaptation of an avian influenza virus to a mammalian host Proc Natl Acad Sci USA 2005, 102:18590-18595 Hatta M, Gao P, Halfm...

Ngày tải lên: 20/06/2014, 01:20

... Murti KG: Assembly of influenza virus Ribonucleoprotein in vitro using Recombinant Nucleoprotein Virology 1987, 156:396-403 Ruigrok RW, Baudin F: Structure of influenza virus ribonucleoprotein particles ... neutralization) is also known for influenza virus NP [15] and antigenic epitope depending on NP-NP association probably takes part in this mechanism together with t...

Ngày tải lên: 20/06/2014, 01:20

... Reichenbach [3] introduced the notions of "context of discovery" and "context of justification" into the study of science The former belonged to the domain of historians, the latter to philosophers Unfortunately, ... trying to impose narrow norms and methods on scientific practice and today emphasizes the diversity of methods and of the means of discovery and justifi...

Ngày tải lên: 20/06/2014, 01:20

... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAU...

Ngày tải lên: 20/06/2014, 01:20

... the time point for the importation of the resistant strain is shifted towards the initial phase of the epidemic, the resistant strain increasingly replaces the sensitive strain (Figure 1c) Early ... has been circulating in the population for many years without pandemic potential and leaving the population at least partially immune The implications for avian infl...

Ngày tải lên: 20/06/2014, 01:20

... noitcaer semit-01 fo lµ gniniatnoc erutxim noitcaer a ni demrofrep saw RCP Co03− ta derots saw noitcudorp ANDc ehT nim rof Co59 ta tpek saw neht ,htab retaw a ni nim 06 rof Co24 ta detabucni saw ... gnirud ylatI ni gniretniw lwofretaw dliw ni sesuriv azneulfni fo noitalucriC I illetanoD ,G izzagiraB ,V itrebuG ,M ugoleD ,L inarT iD ,E iniffaR ,L illetipmaC ,EG inoF ,AM ocraM eD 589-079 ,92 .....

Ngày tải lên: 07/08/2014, 18:21

... distribution of the virus in the intranasally infected chickens, ducks and quails, we collected samples of the lung, brain, kidney and heart from the chickens and quails that died on and 4-5 DPI, ... affects the pathogenicity of Asian highly pathogenic avian influenza H5N1 viruses in ducks Virus Res 2007, 130, 151-161 Pantin-Jackwood MJ, Swayne DE Pa...

Ngày tải lên: 07/08/2014, 23:22

... of animals tested **Indirect ELISA could not be used to test goose or duck sera Evaluation of a competitive ELISA for antibody detection against avian influenza virus 327 significant correlation ... 4987-4995 Evaluation of a competitive ELISA for antibody detection against avian influenza virus 329 Chomel JJ, Thouvenot D, Onno M, Kaiser C, Gourr...

Ngày tải lên: 07/08/2014, 23:22

... 10.1186/1423-0127-17-13 Cite this article as: Shih et al., Pyrazole compound BPR1P0034 with potent and selective anti-influenza virus activity Journal of Biomedical Science 2010, 17:13 ... were infected with influenza virus A/WSN/33 (MOI = 5) and incubated with or without μM BPR1P0034 in the adsorption and postinfection stages The cells were fixed at or h p.i...

Ngày tải lên: 10/08/2014, 05:21

... Cite this article as: Abdel-Moneim et al., Isolation and characterization of highly pathogenic avian influenza virus subtype H5N1 from donkeys Journal of Biomedical Science 2010, 17:25 ... Fatal avian influenza A H5N1 in a dog Emerg Infect Dis 2006, 12:1744-1747 11 Li HY, Yu K, Yang H, Xin X, Chen J, Zhao P, Bi Y: Isolation and characterization of H5...

Ngày tải lên: 10/08/2014, 05:21

... Rapid and specific influenza virus detection by functionalized magnetic nanoparticles and mass spectrometry Tzu-Chi Chou 1, Wei Hsu 2,3, Ching-Ho ... sensitivity and specificity The data demonstrated the combined use of the antibody–MNP and MALDI–MS methods for the sensitive detection of influenza viruses and rapid screening of virus subtypes The specific...

Ngày tải lên: 11/08/2014, 08:20

... as: Eng et al.: PCEP enhances IgA mucosal immune responses in mice following different immunization routes with influenza virus antigens Journal of Immune Based Therapies and Vaccines 2010 8:4 ... Protection against influenza virus infection by vaccine inoculated intranasally with cholera toxin B subunit Vaccine 1988, 6:409-413 27 Tamura S, Ito Y, Asanum...

Ngày tải lên: 11/08/2014, 08:21

... proteins with yield of 0.05 mg per 100 ml cells These recombinant proteins could elicit specific antibody response against avian influenza virus (H5N1) antigen tested by ELISA The protecting antibody ... and COS-7 cellls, were administered in mice in combination with adjuvant, was capable of eliciting antibody specific for avian influenza virus, detect...

Ngày tải lên: 11/08/2014, 10:23