Fuzzy Control of a Gantry Crane System

Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system

... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the system in a local area Second, the DMC controller is a model-based controller ... controlling the temperature in a room deploying a displacement ventilation HVAC system without heater It is a nonlinear system with large disturbance, which has delay in the control variable and in the...

cirstea, m. n. (2002). neural and fuzzy logic control of drives and power systemsl

... open-loop control systems 4 Neural and Fuzzy Logic Control of Drives and Power Systems (E) The method of generating the control pulses: • Single-channel control systems • Multi-channel control ... by the desired power frequency and 26 Neural and Fuzzy Logic Control of Drives and Power Systems N is the number of sampling points in one cycle of the carrier signal For a 50 Hz power frequency, ... • Application of adjustable speed a.c drives to constant speed process control, thereby saving energy 6 Neural and Fuzzy Logic Control of Drives and Power Systems • Replacement of heat engines...

Proceedings VCM 2012 40 nonlinear adaptive control of a 3d overhead crane

... Raja Ismail, M .A Ahmad, M.S Ramli, F.R.M Rashidi, Nonlinear Dynamic Modeling and Analysis of a 3-D Overhead Gantry Crane System with Payload Variation, ems, pp.350354, 2009 Third UKSim European ... uncertainties in crane dynamics Adaptive controller for 2D modeling overhead crane with the friction force model (Aschemann, 2000) was proposed by Ma, Fang & Zhang (2008) An adaptive tracking control ... Fig VCM2 012 Sway angle q (t ) Sway angle f(t ) In this paper, a 5-DOF dynamic model of the 3D overhead crane was developed under the effects of friction forces and the unknown parameters A nonlinear...

Design and control of a teleoperation system for humanoid walking

... user a full information for the hardware and software interface The humanoid robot weighs 6kg and stands 48cm tall It has a total of 20 Degree of Freedom (DOF) - DOF each leg and DOF each arm ... researchers adopt for bipedal walking Section 2.2 is an overview of teleoperation and classifications of the control methods of teleoperation system 2.1 Bipedal Walking Control Achieve stable walking ... fire disaster area, or radiation in the nuclear plant, etc Taking advantage of the advancement in bipedal walking control, several humanoid robots, namely the Honda Asimo (Hirai, 1998) and Sony...

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of access (any combination of read, write, and ... A data manager passes data for a memory object to the kernel by using the pager_data_provided call This call specifies the location of the data within the memory object, and includes the memory...

23
1,290
1

A park like transformation for the study and the control of a nonsinusoidal brushless DC motor

... therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features ... pulsating torque (the homopolar part) and a two-phase motor with a rotating field (the "ap" The classical Park transformation is, in fact, the succesion of two transformations The first trandormation ... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb...

Tài liệu ime Control of a Three Phase 4 Wire PWM Inverter with Variable DC Link Voltage and Battery Storage for PV Application doc

... grad r dually as a re esult of the c controllable dc link volta as indica in the ri age ated ight hand sub b diagram d Figure capacitor v voltage of the output filt with unbalanced load and controlled ... small compared to the dc voltage portion, so that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital Control of three- Phase Inverter ... Inverter with LC Filter", IEEE Transactions on Power Electronics, Vol 6, No 1, January 1991, pp 62-72 [2] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Dead Beat Control of threePhase PWM Inverter" ,...

Tài liệu Stability and Control of Large-Scale Dynamical Systems pptx

... Decentralized Control and Large-Scale Impulsive Dynamical Systems Hybrid Decentralized Control for Large-Scale Dynamical Systems Interconnected Euler-Lagrange Dynamical Systems Hybrid Decentralized Control ... rejection, stability of feedback interconnections, and optimality for large-scale dynamical systems The design and implementation of control law architectures for largescale interconnected dynamical systems ... DiscreteTime Large-Scale Nonlinear Dynamical Systems 168 8.4 Specialization to Discrete-Time Large-Scale Linear Dynamical Systems 173 8.5 Stability of Feedback Interconnections of Discrete-Time Large-Scale...

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

The Design and Implementation of a Sequence Database System * docx

... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Proceedings of the International Conference ... that drill down and up the dimensions) There are also severalopen researchissuesin the design of systemsbasedon the E-ADT paradigm, and in extensions of the paradigm to handle optimizations that...

Báo cáo khoa học: "DESIGN OF A MACHINE TRANSLATION SYSTEM " pptx

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to accommodate the ... serving as the head of a ccmplex D~minal structure with several ccsplements, the translation of the noun into an infini- 4.4 CONSIDERATIONS FOR TRANSLATION The goal of the system, and perhaps of MT...

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... propose a joint learning method for pivot language-based paraphrase generation The jointly learned dual SMT system which combines the training processes of two SMT systems in paraphrase generation,...

Báo cáo khoa học: "Dialog Control in a Natural Language System" docx

... achieve a state (STATEX) In assumption 1, (STATEX) is in fact specialized for a consultation system as a real world state (instead of a mental state which is the general assumption in any dialog ... restrictive assumptions that the acceptance of the proposal is (implicitly) anticipated, and that modifications of a want or of a proposal are not manageable In a more elaborated version, the goal accomplishment ... (HAS-ACTION R (EXISTA (ACTION A) )))) NOW) A (-= (KNOW USERRNOW)) 3: (AUGMENT S) Inference drawn from a user want referring to a state, given his/her acquaintance with the associated causal relation...

Measuring the Economic Value of a City Park System docx

... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... tive value of percent as the amount tax receipts that parkland adds to the assessed value of all dwellings within 500 feet of parks (The preponderance of studies has revealed that excellent parks ... university quadrangles, and corporate campuses.) Third, the amount and characteristics of rainfall are calculated from U.S weather data The model (which Philadelphia Department of Parks and Recreation...

báo cáo hóa học: "Principal components analysis based control of a multi-dof underactuated prosthetic hand" docx

... doi:10.1186/1743-0003-7-16 Cite this article as: Matrone et al.: Principal components analysis based control of a multi-dof underactuated prosthetic hand Journal of NeuroEngineering and Rehabilitation 2010 7:16 Submit ... Ferrata 1, 27100 Pavia, Italy 2ARTS Lab, Scuola Superiore Sant’Anna, V.le Piaggio 34, 56025 Pontedera (PI), Italy 3EUCENTRE Foundation, Via Ferrata 1, 27100 Pavia, Italy Page 12 of 13 Authors’ contributions ... of biomechanical synergies and how they can be applied to a 17 DoFs robot anthropomorphic hand, by mechanically implementing Principal Components Analysis (PCA) and using common patterns of actuation...

Xem thêm

Từ khóa: construction operation and control of a complex solar drying and hot water supply system example fuzzy logic control of a servomechanism control of a complex system dialog control in a natural language system robust nonlinear control of a hypersonic aircraft development of a recipe management system state of a process operating system what is the use of a distributed file system what is a disadvantage of a distributed operating system robust nonlinear control of a hypersonic aircraft based on sliding mode control robust nonlinear control of a hypersonic aircraft in the presence of aerothermoelastic effects optimal control of linear time delay systems dynamic modelling and control of a wheeled mobile robot control of linear uncertain timedelay systemsa projection approach state space representation of a closed loop system Một số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTP Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùng Nghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000 Thơ nôm tứ tuyệt trào phúng hồ xuân hương Chuong 2 nhận dạng rui ro Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật Trách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Chiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015 HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM MÔN TRUYỀN THÔNG MARKETING TÍCH HỢP