Fuzzy Control of a Gantry Crane System

... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...

Ngày tải lên: 05/09/2013, 16:11

... open-loop control systems 4 Neural and Fuzzy Logic Control of Drives and Power Systems (E) The method of generating the control pulses: • Single-channel control systems • Multi-channel control ... by the desired power frequency and 26 Neural and Fuzzy Logic Control of Drives and Power Systems N is the number of sampling points in one cycle...

Ngày tải lên: 18/04/2014, 12:29

... Raja Ismail, M .A Ahmad, M.S Ramli, F.R.M Rashidi, Nonlinear Dynamic Modeling and Analysis of a 3-D Overhead Gantry Crane System with Payload Variation, ems, pp.350354, 2009 Third UKSim European ... uncertainties in crane dynamics Adaptive controller for 2D modeling overhead crane with the friction force model (Aschemann, 2000) was proposed by Ma, Fang & Zhang (2008) An ad...

Ngày tải lên: 16/08/2015, 15:47

... user a full information for the hardware and software interface The humanoid robot weighs 6kg and stands 48cm tall It has a total of 20 Degree of Freedom (DOF) - DOF each leg and DOF each arm ... researchers adopt for bipedal walking Section 2.2 is an overview of teleoperation and classifications of the control methods of teleoperation system 2.1 Bipedal...

Ngày tải lên: 04/10/2015, 10:25

... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of ac...

Ngày tải lên: 12/09/2012, 15:05

... therefore in this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features ... pulsating torque (the homopolar part) and a two-phase motor with a rotating field (the "ap" The classical Park transformation is, in fact, the succ...

Ngày tải lên: 03/01/2014, 19:44

... grad r dually as a re esult of the c controllable dc link volta as indica in the ri age ated ight hand sub b diagram d Figure capacitor v voltage of the output filt with unbalanced load and controlled ... small compared to the dc voltage portion, so that it does not affect the output voltage References [1] Takao Kawabata, Takeshi Miyashita and Yushin Yamamoto, "Digital...

Ngày tải lên: 19/01/2014, 02:20

... Decentralized Control and Large-Scale Impulsive Dynamical Systems Hybrid Decentralized Control for Large-Scale Dynamical Systems Interconnected Euler-Lagrange Dynamical Systems Hybrid Decentralized Control ... rejection, stability of feedback interconnections, and optimality for large-scale dynamical systems The design and implementation of control la...

Ngày tải lên: 12/02/2014, 16:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Procee...

Ngày tải lên: 16/03/2014, 16:20

... accordance with these considerations Ccmputational considerations In a transfer-based MT system, actual translation takes place in transfer and can be described as the ocr~putaticnal manipulation ... influenced by target language considerations: the interface structure between analysis and transfer was defined to take advantage of the similarities between the three languages and to acc...

Ngày tải lên: 17/03/2014, 19:21

... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...

Ngày tải lên: 23/03/2014, 14:20

... achieve a state (STATEX) In assumption 1, (STATEX) is in fact specialized for a consultation system as a real world state (instead of a mental state which is the general assumption in any dialog ... restrictive assumptions that the acceptance of the proposal is (implicitly) anticipated, and that modifications of a want or of a proposal are not manageable In a more elabor...

Ngày tải lên: 24/03/2014, 05:21

... Philadelphia Philadelphia parks have support galore In fact, there are more than 100 “friends of parks” organizations Two of them, the Philadelphia Parks Alliance and Philadelphia Green, operate ... tive value of percent as the amount tax receipts that parkland adds to the assessed value of all dwellings within 500 feet of parks (The preponderance of studies has reveale...

Ngày tải lên: 02/04/2014, 08:20

... doi:10.1186/1743-0003-7-16 Cite this article as: Matrone et al.: Principal components analysis based control of a multi-dof underactuated prosthetic hand Journal of NeuroEngineering and Rehabilitation 2010 7:16 Submit ... Ferrata 1, 27100 Pavia, Italy 2ARTS Lab, Scuola Superiore Sant’Anna, V.le Piaggio 34, 56025 Pontedera (PI), Italy 3EUCENTRE Foundation, Via Ferrata 1, 27...

Ngày tải lên: 19/06/2014, 08:20