research human capital investments and interregional wage differences in a southeast asian country

Ngày tải lên: 25/12/2015, 17:19

Ngày tải lên: 30/03/2014, 01:20

Ngày tải lên: 07/03/2014, 02:20

... investment and the thriftiness of consumers 14.17 The markets for capital and land The derived demand curve for capital (and for land) services closely parallels the earlier analysis of labour demand ... employment, the more inelastic is industry labour demand 13.6 Discrimination? Women and non-whites on average receive lower incomes than white males  women and non-whites are conce...

Ngày tải lên: 03/02/2015, 15:25

... by providing detailed stylized facts on capital flows and business cycles in the Asia Pacific region and by empirically analyzing the relationship between capital flows and business cycles For ... dynamics of the Asia Pacific countries, for example, whether capital flows generate boom-bust cycles, and whether capital flows help explain the sy...

Ngày tải lên: 24/10/2012, 09:27

... intermittent control, and some exponential stability criteria are established Finally, some conclusions and remarks are drawn in Section Problem Formulation and Preliminaries Consider a class of nonlinear ... ≥ to denote a positive negative, seminegative, and semipositive definite matrix P Journal of Inequalities and Applications Exponential Stabilization of a C...

Ngày tải lên: 21/06/2014, 06:20

... on Wireless Communications and Networking nodes in the heterogeneous WSNs has been considered in [12, 13] In this paper, we investigate secure clustering of wireless sensor nodes with evaluating ... information exchange prior to and after deploying sensor nodes and gateways: (a) embedding keys into gateways and sensor nodes, (b) information exchange between sens...

Ngày tải lên: 21/06/2014, 11:20

... Journal of Inequalities and Applications References R P Agarwal, S Ding, and C Nolder, Inequalities for Differential Forms, Springer, New York, NY, USA, 2009 S Ding, “Lipschitz and BMO norm inequalities ... -weighted imbedding inequalities for A-harmonic tensors,” Journal of Mathematical r Analysis and Applications, vol 273, no 2, pp 667–676, 2002 C A Nolder, Hardy-Little...

Ngày tải lên: 21/06/2014, 18:20

... δ 3.9 By 3.8 and 3.9 , and 3.5 we obtain Sw Sxβ Sxγ ≤ δ P Q Sw δ u 3 .10 ≤ δ xβ xδ δ Hence w ≤ δ 2 Finally, from 3.7 and 3 .11 we have w − 1/ 2 ≤ w ≤ Therefore, if δ < AMC property √ δ2 3δ δ δ ... Sxβ , QSxγ QSxβ 0, P Sxγ δ and Sxβ − Sxγ ≤ , Sxγ , 0, for all y ∈ Y , P y Qy Therefore, since en is 1- unconditional Sxβ Sxγ QSxβ P Sxγ QSxβ −...

Ngày tải lên: 21/06/2014, 20:20

... Fixed Point Theory and Applications We give another axiom for symmetric spaces and study their relationships in Section We give common fixed-point theorems of four mappings in symmetric spaces and ... necessity of axioms in Section Axioms on symmetric spaces A symmetric on a set X is a function d : X × X → 0, ∞ satisfying the following conditions: y for x, y ∈ X, i d...

Ngày tải lên: 21/06/2014, 23:20

... and A Ganz, Packet scheduling for QoS support in IEEE 802.16 broadband wireless access systems,” 12 [17] [18] [19] [20] [21] [22] [23] EURASIP Journal on Wireless Communications and Networking ... Bharghavan, and R Srikant, Fair scheduling in wireless packet networks,” IEEE/ACM Transactions on Networking, vol 7, no 4, pp 473–489, 1999 [9] T S Eugen Ng, I Stoica,...

Ngày tải lên: 21/06/2014, 23:20

... number of participants 55 or older and examining the differences in lifespan distribution among men and women, respectively, along with the possible combined effect of gender and age on PTSD ... precedent for the combined effect of gender and age on PTSD or for the lifespan distribution of PTSD Future research To conclude on the m...

Ngày tải lên: 09/08/2014, 01:21

... CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions ... doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infe...

Ngày tải lên: 10/08/2014, 05:21

... than the inhibition of cyclooxigenase activity, typical of nonsteroidal anti-inflammatory drugs (NSAIDs), and thus devoid of irritant effects on the gastric mucosa and suitable for use in chronic ... stimulus minus basal adhesion, and b is adhesion elicited by stimulus minus basal adhesion Prostacyclin and Prostaglandin E2 enzyme immunoassay The effect of IL-1α on th...

Ngày tải lên: 11/08/2014, 08:21

... Real-time imaging and analysis of differences in cadmium dynamics in rice cultivars (Oryza sativa) using positron-emitting 107Cd tracer Satoru Ishikawa1*§, Nobuo ... to grains in typical rice cultivars that differed in grain Cd concentrations We used positron-emitting 107Cd tracer and an innovative imaging technique, the positron-emitting tr...

Ngày tải lên: 11/08/2014, 11:21