Báo cáo sinh học alignminer a web based tool for detection of divergent regions in multiple sequence alignments of conserved sequences

Báo cáo sinh học    alignminer  a web based tool for detection of divergent regions in multiple sequence alignments of c

Báo cáo sinh học alignminer a web based tool for detection of divergent regions in multiple sequence alignments of c

... Plant Plant Arabidopsis thaliana AtGS1 isoform AY088312 Arabidopsis thaliana Arabidopsis thaliana AtGS1 isoform AtGS1 isoform AY059932 AK118005 AC# (amino acid) Q56WN1 70% Q9LVI8 Plant Oryza sativa ... results can be inspected graphically via an innovative, interactive graphical interface developed in AJAX, or saved in any of several formats Implementation Architecture AlignMiner is...

Ngày tải lên: 20/12/2015, 08:16

16 292 0
Báo cáo y học: "GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists" ppsx

Báo cáo y học: "GENECODIS: a web-based tool for finding significant concurrent annotations in gene lists" ppsx

... values in real datasets Very extreme scenarios, such as extracting all possible combinations of terms that appear in at least one gene (support value of 1), is in many cases a computationally ... out that, in this particular case, the 'protein phosphorylation' category is mainly related to proteins that are involved in cell cycle Indeed, activation and inhibition of many key reg...

Ngày tải lên: 14/08/2014, 17:22

8 270 0
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc

Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc

... Friedman and Maniatis Genome Biology 2011, 12:R69 http://genomebiology.com/2011/12/7/R69 SOFTWARE Open Access ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene...

Ngày tải lên: 09/08/2014, 23:20

12 394 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

... roles in initial evaluation and staging of patients, ART initiation, and patient monitoring [3] As nurses are becoming increasingly central points of contact for clinical care of people living ... overall quality of HIV/ AIDS care and treatment in the country Education in HIV/ AIDS is now an integral part of the four national nursing schools in Haiti This was achieved using a...

Ngày tải lên: 18/06/2014, 17:20

7 377 0
Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx

Báo cáo sinh học: "iTriplet, a rule-based nucleic acid sequence motif finder" pptx

... Davila J, Balla S, Rajasekaran S: Fast and practical algorithms for planted (l, d) motif search IEEE/ACM Trans Computational Biology & Bioinformatics 2007, 4:544-52 Pisanti N, Carvalho AM, Marsan ... [14] Transfac ID: R08298 c-fos serum response element promoter+5' UTR Remarks CCATATTAGGACATCTGCGT CCAAATTTG CCATATTAGGACA CAGGATGTCCATATTAGGACATC model Ref [17] Ref [14] Transfac ID: ... Luci...

Ngày tải lên: 12/08/2014, 17:20

14 262 0
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

... normalization method as in [19], which includes base 10 log-transformation as well as normalization to mean and variance For the data that contains negative values, we not perform log-transformation ... approach and the classifier List of abbreviations ANMM4CBR: additive nonparametric margin maximization for case-based reasoning; ANMM: additive nonparametric margin maximization; NM...

Ngày tải lên: 12/08/2014, 17:20

11 373 0
Báo cáo y học: ":RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes" potx

Báo cáo y học: ":RASTA-Bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes" potx

... method for identifying all potential TA systems in a given bacterial genome: Rapid Automated Scan for Toxins and Antitoxins in Bacteria (RASTA-Bacteria) This method is based on the genomic features ... of the candidates presently requires manual analysis RASTA-Bacteria also identified numerous candidates displaying the HTH-DNA binding domains When adjacent to an unambiguous toxin...

Ngày tải lên: 14/08/2014, 08:20

14 335 0
Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

Báo cáo y học: "yrGATE: a web-based gene-structure annotation tool for the identification and dissemination of eukaryotic genes" pdf

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGA...

Ngày tải lên: 14/08/2014, 16:21

11 467 0
Báo cáo toán học: "Evaluating a Weighted Graph Polynomial for Graphs of Bounded Tree-Width" potx

Báo cáo toán học: "Evaluating a Weighted Graph Polynomial for Graphs of Bounded Tree-Width" potx

... algebra and weighted graphs Advances in Soviet Mathematics, 21:135–145, 1994 [12] J Edmonds Systems of distinct representatives and linear algebra Journal of Research of the National Bureau of Standards ... Many well-studied classes of graphs have bounded tree-width: for instance, seriesparallel networks are the graphs with tree-width at most two A large class of gr...

Ngày tải lên: 07/08/2014, 21:21

14 234 0
Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx

... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... than half of the array resolution, with array resolution defined as the distance between the start of one arrayed element and the start of the next Thereby, the...

Ngày tải lên: 14/08/2014, 15:20

8 334 0
Báo cáo sinh học: "Optimised electroporation mediated DNA vaccination for treatment of prostate cancer" doc

Báo cáo sinh học: "Optimised electroporation mediated DNA vaccination for treatment of prostate cancer" doc

... demonstrated the potential for electroporation (EP) mediated DNA vaccination with PSCA [17] In the present study, we focus on optimisation of in vivo DNA plasmid vaccination, in terms of dose schedule ... Optimised electroporation mediated DNA vaccination for treatment of prostate cancer Genetic Vaccines and Therapy 2010 8:1 Submit your next manuscript to BioM...

Ngày tải lên: 14/08/2014, 19:22

13 188 0
báo cáo hóa học:" Research Article Jitter Estimation Algorithms for Detection of Pathological Voices" doc

báo cáo hóa học:" Research Article Jitter Estimation Algorithms for Detection of Pathological Voices" doc

... the three jitter models that were used, followed by a description of the jitter estimation algorithms that were evaluated A comparison of the algorithms for both pitch marking and jitter estimation ... leading to a more realistic measurement of local pathologic jitter This third model is the base for a new method for jitter estimation Jitter Estimation Alg...

Ngày tải lên: 21/06/2014, 20:20

9 348 0
Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

Báo cáo khoa học: TICL – a web tool for network-based interpretation of compound lists inferred by high-throughput metabolomics doc

... a great demand for bioinformatics to provide a statistically valid interpretation of compound lists produced experimentally Currently, several bioinformatics approaches are available for metabolomics ... propose an analytical framework for the interpretation of molecular mechanisms that unite a list of compounds This analytical framework is implemented as the freel...

Ngày tải lên: 16/03/2014, 01:20

11 402 0
Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf

Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf

... Conference on Natural Language Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve ... Extraction (IE) tasks (Figure 2) Additional aspects of annotations can be marked using attributes, binary or multi-valued flags that can be added to other annotations Finally, annotators...

Ngày tải lên: 17/03/2014, 22:20

6 335 0
Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

Báo cáo sinh học: "HuMiTar: A sequence-based method for prediction of human microRNA targets" ppt

... authors read and approved all versions of the manuscript Additional material Additional File Supplement for article entitled "HuMiTar: A sequence-based method for prediction of human microRNA ... prediction for plants is easier than for animals [26,27]; and (2) identification of miR targets is critical to advancing understanding of human diseases, such as c...

Ngày tải lên: 12/08/2014, 17:20

12 621 0
Từ khóa:
w