Numerical studies on physiological pulsatile flow through stenotic tubes
Numerical studies on physiological pulsatile flow through stenotic tubes
... NUMERICAL STUDIES ON PHYSIOLOGICAL PULSATILE FLOW THROUGH STENOTIC TUBES LIU XI NATIONAL UNIVERSITY OF SINGAPORE 2007 NUMERICAL STUDIES ON PHYSIOLOGICAL PULSATILE FLOW THROUGH STENOTIC TUBES ... Chapter NUMERICAL STUDY ON PULSATILE FLOW THROUGH DOUBLE CONSTRICTIONS 7.1 Model Configuration 71 74 75 7.1.1 Model Description 75 7.1.2 Physiological...
Ngày tải lên: 27/11/2015, 11:19
Numerical simulation of steady and pulsatile flow through smoothly constricted tube
... NUMERICAL SIMULATION OF STEADY AND PULSATILE FLOW THROUGH SMOOTHLY CONSTRICTED TUBE LI GENG CAI ( B ENG., SHANGHAI JIAOTONG UNIVERSITY ) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... the flow instantaneous streamline behaviors Three types of pulsatile flow, namely the physiological pulsatile flow, equivalent physiological flow and sinus...
Ngày tải lên: 27/11/2015, 11:18
Numerical studies on collective motion and polymer statistics
... biology, namely the collective motion and polymer statistics The first part of the thesis focuses on collective motion Collective motion, or flocking behaviour studies the common coordinated behaviour ... NUMERICAL STUDIES ON COLLECTIVE MOTION AND POLYMER STATISTICS WANG NAN (B.Sc.(Hons), National University of Singapore) A THESIS SUBMITTED FOR ... distrubut...
Ngày tải lên: 09/09/2015, 08:17
Numerical studies on quantized vortex dynamics in superfludity and superconductivity
... Weimann and Ketterle in 2001 for their decisive contributions to BoseEinstein condensation and to Ginzburg, Abrikosov and Leggett in 2003 for their pioneering contributions to superfluidity and superconductivity ... Bose-Einstein condensate GLSE Ginzburg–Landau–Schr¨dinger equation o GLE Ginburg–Landau equation NLSE Nonlinear Schr¨dinger equation o CGLE complex Ginburg–Landau equ...
Ngày tải lên: 10/09/2015, 09:30
Experimental and numerical studies on the viscoelastic behavior of living cells
... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR...
Ngày tải lên: 12/09/2015, 11:01
Numerical studies on the zakharov system
... Mass of the ions Ne Number density of the electrons Ni Number density of the ions ve Velocity of the electrons vi Velocity of the ions pe Pressure of the electrons pi Pressure of the ions γe Specific ... contribution of the mean electron field cs The speed of sound ζd Debye length x List of Symbols µm The ratio of the electron to the ion masses D The wave energy P T...
Ngày tải lên: 27/11/2015, 11:19
finitte difference time domain studies on optical transmission through planar
... incident light to be considered is monochromatic and linearly polarized along the y-direction ridged) are compared in terms of transmission efficiency, field distribution, signal contrast, spot size, ... [Fig 3(i)] due to the evanescent wave through the aperture channel, the transmission efficiency is as low as 0.0038 In contrary, the optical transmission efficiency through the Hshaped a...
Ngày tải lên: 06/05/2014, 08:53
finitte difference time domain studies on optical transmission through planar
... incident light to be considered is monochromatic and linearly polarized along the y-direction ridged) are compared in terms of transmission efficiency, field distribution, signal contrast, spot size, ... [Fig 3(i)] due to the evanescent wave through the aperture channel, the transmission efficiency is as low as 0.0038 In contrary, the optical transmission efficiency through the Hshaped a...
Ngày tải lên: 06/05/2014, 08:55
A numerical study on the deformation of liquid filled capsules with elastic membranes in simple shear flow
... spheroidal capsules with various membrane laws under shear flow The transient deformation of capsules with initially biconcave disk shape was also simulated The unsteady tank treading motion was followed ... the membrane, the capsule undergoes periodic shape deformation and inclination oscillation; the inclination oscillation amplitude increases as the shear ra...
Ngày tải lên: 11/09/2015, 16:08
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...
Ngày tải lên: 23/11/2012, 15:04
Effect of periodic suction on three dimensional flow and heat transfer past a vertical porous plate embedded in a porous medium
... Bull Malays Math Sci Soc 2006, 29(1), 33-42 [15] Das S S., Satapathy A. , Das J K., Panda J P Mass transfer effects on MHD flow and heat transfer past a vertical porous plate through a porous medium ... 927-941 [9] Sattar M A Free convection and mass transfer flow through a porous medium past an infinite vertical porous plate with time depend...
Ngày tải lên: 05/09/2013, 14:58
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf
... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...
Ngày tải lên: 18/02/2014, 12:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc
... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purificat...
Ngày tải lên: 18/02/2014, 16:20