NMR structural studies on the pilin monomer pils from salmonella typhi
NMR structural studies on the pilin monomer pils from salmonella typhi
... (Thompson, 1994) R64: Prepilin from Plasmid R64 Type IVb pilus PilS: Prepilin from Salmonella typhi Type IVb pilus GC: Prepilin from Nesseria gonorrhoeae MS11 Type IVa pilus PAK: Prepilin from ... Comparison of the pilin structures of these two subclasses (Type IVa and IVb) suggested that Type IV pilins share a conserved architectural scaffold - 16 - PilS from Salmonella...
Ngày tải lên: 26/11/2015, 23:07
Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot
... In immunotype 1, the outer core has at least one O-acetylation site and the O-acetyl group is present in the core of a minority of the LPS molecules The position of the O-acetyl groups in the core ... all of the data together, the structures of the core and core with one O-polysaccharide repeating unit in the LPS of P aeruginosa immu...
Ngày tải lên: 24/03/2014, 03:21
STUDIES ON THE SYNTHESIS OF WOLLASTONITE FROM RICE HUSK ASH AND LIMESTONE (Full Thesis) NGHIÊN CỨU VỀ TỔNG HỢP wollastonite từ vỏ trấu ASH và đá vôi
Ngày tải lên: 20/10/2014, 21:48
Studies on the hyaluronidase enzyme purified from the venom of chinese red scorpion buthus martensi karsch
... STUDIES ON THE HYALURONIDASE ENZYME PURIFIED FROM THE VENOM OF CHINESE RED SCORPION BUTHUS MARTENSI KARSCH A thesis submitted by FENG LUO (B.Med., M.Med.) for the degree of DOCTOR OF PHILOSOPHY ... Gopalakrishnakone, P., Cloning and molecular characterization of BmHYA1, a novel hyaluronidase from the venom of Chinese red scorpion Buthus...
Ngày tải lên: 14/09/2015, 08:48
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
... compilation ª 2009 FEBS 2101 Interaction of EW29Ch with sugars H Hemmi et al constants by NMR to analyze the interaction between the protein and lactose in a solution state As mentioned above, one of ... affect the dissociation constants By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the fast exchange regime, Kd value...
Ngày tải lên: 23/03/2014, 04:21
Structural, electrical and optical studies on the effects of rapid thermal processing on silicon germanium carbon films
... STRUCTURAL, ELECTRICAL AND OPTICAL STUDIES ON THE EFFECTS OF RAPID THERMAL PROCESSING ON SILICONGERMANIUM -CARBON FILMS FENG WEI (M Eng, XJTU) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... was explained based on the theory of binary alloy oxidation and the consideration of large difference in the heat of formation of SiO2 and GeO2 R...
Ngày tải lên: 17/09/2015, 17:18
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx
... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calc...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Comparative studies on the functional roles of N- and C-terminal regions of molluskan and vertebrate troponin-I pdf
... 6A,B) In the present study, we compared the functional roles of the N- and C-terminal regions of 4482 H Tanaka et al molluskan and vertebrate TnI and revealed for the first time that (a) the alternative ... of the troponin complex In molluskan muscles, the C-terminal region does not function and troponin regulates contraction only through the act...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: Studies on the nonmevalonate pathway of terpene biosynthesis The role of 2C-methyl-D -erythritol 2,4-cyclodiphosphate in plants docx
... group of Glu207 into phytoene (the main labeled component of the lipidsoluble fraction) is systematically diminished by the addition of increasing amounts of [1-3H ]2C-methyl-D -erythritol 4-phosphate ... Formation of 4-(cytidine 50 -diphospho)-2-C-methyl-D -erythritol from 2-C-methyl-D -erythritol 4-phosphate by 2-C-methyl-D -erythritol 4-phosphate cytidyltran...
Ngày tải lên: 22/02/2014, 07:20
Case Studies on the Effectiveness of State Financial Incentives for Renewable Energy pdf
... regions of the state On the other hand, only a small fraction of those claiming the tax credit take advantage of the low-interest loan Furthermore, the property-tax exemption complements the ... National Laboratory, Matthew Brown of the National Conference of State Legislatures, Jane Weissman of the Interstate Renewable Energy Council, Frederick Beck of...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf
... co-expressing dopamine D1 and D2 fusion proteins (D1 CFP and D2R1–YFP – genetic variant of dopamine D2 receptor) d Measured in cell co-expressing dopamine D1 and D2 fusion protein (D1 CFP and D2R2–YFP ... two dopamine D2 receptor fusion proteins (D2 CFP and D2 YFP) f Measured in cell co-expressing two dopamine D2 receptor fusion proteins (D2 CFP...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Biosynthesis of isoprenoids – studies on the mechanism of 2C-methyl-D-erythritol-4-phosphate synthase pdf
... above, these initial conditions were rapidly conducive to steady conditions where and were present in very similar concentrations, and the rates of the forward reaction (conversion of to 3) and the ... Discussion The main part of the present study was a search, under conditions of maximal stringency, for fragment exchange that could be the hallmark of the hypothetical...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Isothermal unfolding studies on the apo and holo forms of Plasmodium falciparum acyl carrier protein Role of the 4¢-phosphopantetheine group in the stability of the holo form of Plasmodium falciparum acyl carrier protein docx
... The chaotrope-induced unfolding was almost fully reversible in both forms of the protein Removal of the perturbation makes the protein regain its native form The unfolding reactions of both forms ... as the major and the minor forms of the holoACP structure, on the basis of their percentage contributions (65% and 35%, respectively) to the...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferase Stability studies on the product-activated enzyme potx
... not only in the presence of xanthine and PRPP, but also on formation of the enzyme ⁄ hypoxanthine ⁄ PRPP ternary complex, conditions that represent those used for activation of the enzymes Pronounced ... activation was observed only upon incubation with PRPP and hypoxanthine, and not with guanine and xanthine, the other purine substrates of the enzyme Although no metal io...
Ngày tải lên: 16/03/2014, 18:20