Nano mechanical characterisation of a single electrospun nanofiber

Nano mechanical characterisation of a single electrospun nanofiber

Nano mechanical characterisation of a single electrospun nanofiber

... the mechanical properties of single nanofibers Characterization of hard materials’ such as carbon and quartz is relatively easier compare to soft materials like polymers as manipulation of soft ... quantitative and qualitative analysis on the mechanical properties of nanofibers obtained from the tensile test of single electrospun polymeric nanofibers Polycaprolactone (PCL)...

Ngày tải lên: 26/11/2015, 22:39

122 155 0
Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

Retrieval of the source location and mechanical descriptors of a hysteretically-damped solid occupying a half space by full wave inversion of the the response signal on its boundary doc

... that the retrieval errors of the mechanical descriptors are largest for discordance of the source position x1 and that it is nearly-impossible to obtain a reliable retrieval of the imaginary part ... is the space- frequency solution to the forward problem of the prediction of the vertical component of displacement response to a uniform vertical s...

Ngày tải lên: 18/03/2014, 01:21

26 468 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

... typical hexagonal shape of a N crassa Woronin body (C) A giant rectangular Woronin body is captured from the side (D) A small Woronin body is still attached to a peroxisome (*), representing an intermediate ... (Kansas City, KS, USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR w...

Ngày tải lên: 23/03/2014, 07:20

10 350 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

... both trials The Sleep Quality Scale was correlated with pain and with relevant aspects of another sleep assessment, the MOS Sleep Scale Further, the Sleep Quality scale was responsive to treatment ... Number of Painful Tender Pointsa Baseline Mean Pain Scoreb Sleep Quality Scaleb MOS Sleep Scales Sleep Disturbance Snoring Awaken Short of Breath or with...

Ngày tải lên: 18/06/2014, 18:20

7 597 0
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh a specification ... node Variable bit-rate traffic channel with negotiated QoS parameters used by the mesh network to transport data traffic corresponding to a particular flow Table 4: Transport and physi...

Ngày tải lên: 21/06/2014, 18:20

16 769 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag -H bond Due to the charge transfer from the H to the Si adatom on the 1 9H- Si(111 )7 surface, the H atom ... transfer toward the Si adatom when the H sits on the Si adatom There is a strong covalent bond between the H and the Si rest atom when...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated ... accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

... promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated ... accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with...

Ngày tải lên: 22/06/2014, 22:20

5 276 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx

The Integration of Functions of a Single Variable, by G. H. Hardy pptx

... Integration of Functions of a Single Variable THE INTEGRATION OF FUNCTIONS OF A SINGLE VARIABLE BY G H HARDY SECOND EDITION CAMBRIDGE AT THE UNIVERSITY PRESS 1966 PUBLISHED BY THE SYNDICS OF THE CAMBRIDGE ... sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical f...

Ngày tải lên: 28/06/2014, 19:20

86 262 1
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

... pigs and monkeys on the island of Bali and Java were identical (Fig 2) and corresponded to the PFGE pattern of four of the six S equi subsp zooepidemicus obtained from the original outbreak in ... Streptococcus equi subsp zooepidemicus in the pig and monkey in Indonesia results indicated that the mucoid S equi subsp zooepidemicus clone isola...

Ngày tải lên: 07/08/2014, 18:20

3 314 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... present article we describe the effect of a single dose of abatacept on the humoral response in healthy subjects to two vaccines, tetanus toxoid vaccine and 23-valent pneumococcal vaccine This study ... discontinuation Serum samples were obtained for subjects of Groups A and B at study days 14 and 28, for Group C subjects at study days 28 and 42,...

Ngày tải lên: 09/08/2014, 10:20

11 415 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

... Nishimura G, Kawabata H, Yokoyama H, Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis ... and some patients with type C brachydactyly also present with dysplasia of hip joints [18,19] Recently, a functional single nucleotide polymorphism (SNP) in the...

Ngày tải lên: 09/08/2014, 13:22

5 444 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

... lobectomy years ago CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: Alive D:Dead The postoperative mortality was 12.5% ... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesth...

Ngày tải lên: 10/08/2014, 09:22

7 311 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

... and (e) 435 after the inoculation To measure the localization -dynamics of expressed proteins and the motility of single cells simultaneously, we used the on-chip microcultivation system and assayed ... when bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then...

Ngày tải lên: 11/08/2014, 00:22

4 166 0
Từ khóa:
w