M 5330 blouse with asymmetrical shoulder
Báo cáo khoa học: Solution structure of an M-1 conotoxin with a novel disulfide linkage pdf
... resonance of 4,4-dimethyl-4-silapentane-1-sulfonic acid used as an internal standard Distance restraints and structure calculations An initial survey of distance constraints was performed on a series ... outcome was a set of 20 ˚ structures with a mean global rmsd of 0.56 ± 0.16 A and a ˚ mean global heavy atom rmsd of 1.30 ± 0.28 A Structural refinement was carri...
Ngày tải lên: 30/03/2014, 09:20
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC Common CCAGCTTTCTCCTTCTGTCCCATAA Table Demographics and asymmetrical dimethyl arginine (ADMA) ... Table Table Correlation matrix of asymmetrical dimethyl arginine (ADMA) and inflammatory markers Variation in asymmetrical dimethyl arginine (ADMA) levels with carriage of...
Ngày tải lên: 13/08/2014, 03:20
