... study the assumption was made that the shape of red heartwood results from the conditions of red heart initiation and development until the point in time of observation Referring to Zycha [20] red ... also the red heartwood, in addition to the white beechwood In conclusion, an approach was presented to the modelling of the shape of red heartwo...
Ngày tải lên: 07/08/2014, 16:20
... (+6.1% for the modulus of elasticity and +7.09% for the bending strength) The swelling behaviour of the beech with red heart is slightly increased The hygroscopic behaviour of the red- hearted ... portion of 80% in the fracture surface of the red- hearted samples and a wood failure portion of 90% of the fracture surface of the normal samples g...
Ngày tải lên: 08/08/2014, 00:22
Báo cáo khoa học: "Influence of oak mast on feeding behaviour of red deer (Cervus elaphus L)" pps
... occasional high consumption of acorns, and considered that red deer fed mostly on trees and shrubs rather than on herbs and grasses Our results not support this view In the case of roe deer, ... diet of red deer has been demonstrated in this study Jackson (1977) summarized the limitation of the method: "Thus quantitative comparisons between different foods only approximat...
Ngày tải lên: 08/08/2014, 23:22
báo cáo khoa học: " Construction of a consensus linkage map for red clover (Trifolium pratense L.)" docx
... Imaizumi-Anraku H, Bachmair A, Sandal N, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M, Harada K: Construction of a genetic linkage map of the model legume Lotus japonicus using an intraspecific ... R, Nakamura Y, Kaneko T, Sakurai N, Okumura K, Klimenko I, Sasamoto S, Wada T, Watanabe A, Kohara M, Fujishiro T, Tabata S: Comprehensive structural analysis of the gen...
Ngày tải lên: 12/08/2014, 03:20
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAA...
Ngày tải lên: 12/08/2014, 03:20
báo cáo khoa học: " Mapping of A1 conferring resistance to the aphid Amphorophora idaei and dw (dwarfing habit) in red raspberry (Rubus idaeus L.) using AFLP and microsatellite markers" ppt
... Jennings's hypothesis of linkage between this character and the H and T genes With a view to marker-assisted breeding and map-based gene cloning, there is interest in extending linkage maps to include ... was involved in the planning of the molecular experiments, generated the SSR and AFLP data, scored and analysed the segregation data and drafted the man...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo sinh học: "Genetic variability and differentiation in red deer (Cervus elaphus L) of Central Europe" pps
... result In the French red deer, according to Lang (1987) all animals living in the Vosges originate from a small remaining population in the mountain range of Donon (m 500 individuals in 1870) ... Genetic differentiation in four European subspecies of red deer (Cervus elaphus L) Heredity 51, 561-580 Harris H, Hopkinson DA (1976) Handbook of Enzyme Electrophores...
Ngày tải lên: 14/08/2014, 20:20