... as a model Tables 10: The reasons for the approval the application of giving a text as a model in the future Table 11: The reasons for the disapproval of application of giving a text as a model ... languages department An investigation into the effects of brainstorming and giving a text as model on phan dinh phu...
Ngày tải lên: 18/12/2013, 10:08
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: "A Preference-first Language Processor Integrating the Unification Grammar and Markov Language Model for Speech Recognition-ApplicationS" potx
... to form a complete speech recognition system The language processor consists of a language model and a parser The language model properly integrates the unification grammar and the Markov language ... sentence hypotheses The Laneua~e Model The goal of the language model is to participate in the selection of candidate constituents for a sentenc...
Ngày tải lên: 08/03/2014, 07:20
Báo cáo khoa học: "A Statistical Machine Translation Model Based on a Synthetic Synchronous Grammar" docx
... (Zhang et al., 2008) in our current implementation 2.2 The SSG -based Translation Model The translation in our SSG -based translation model can be treated as a SSG derivation A derivation consists ... Designing Machine Translation Systems Machine Translation, 5(4):265-300 Dekai Wu 1997 Stochastic inversion transduction grammars and bilingual parsing of parallel corpora...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo hóa học: " A fixed-point approach to the stability of a functional equation on quadratic forms" doc
... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation and a Jensen -quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization of the Hyers-Ulam-Rassias stability ... : = ax2 + bxy + cy2 is a solution of the Equation 1.1 The authors [12] acquired the general solution and proved the stability of the funct...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Research Article Stability of a Jensen Type Logarithmic Functional Equation on Restricted Domains and Its Asymptotic Behaviors" pdf
... an alternative functional equation, ” Journal of Mathematical Analysis and Applications, vol 339, no 1, pp 303–311, 2008 19 B Batko, On approximation of approximate solutions of Dhombres’ equation, ” ... and Applications, vol 276, no 2, pp 747–762, 2002 15 J M Rassias and M J Rassias, On the Ulam stability of Jensen and Jensen type mappings on restricted dom...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article Static Object Detection Based on a Dual Background Model and a Finite-State Machine Rub´ n Heras Evangelio and Thomas Sikora e" doc
... Surveillance (AVSS ’07), pp 242–247, London, UK, September 2007 [4] A Singh, S Sawan, M Hanmandlu, V K Madasu, and B C Lovell, “An abandoned object detection system based on dual background segmentation,” ... was detected False detections indicate that an abandoned object was detected where, in fact, there was not an abandoned object (but, for example, a person) Missed d...
Ngày tải lên: 21/06/2014, 07:20
báo cáo hóa học:" Research Article Stability of a Mixed Type Functional Equation on Multi-Banach Spaces: A Fixed Point Approach" pdf
... Stability of a mixed type additive, quadratic, cubic and quartic functional equation, ” in Nonlinear Analysis and Variational Problems, P M Pardalos, Th M Rassias, and A A Khan, Eds., Springer Optimization ... this paper, we will show the Hyers-Ulam-Rassias stability of a mixed type functional equation on multi-Banach spaces using fixed -point methods A Mixe...
Ngày tải lên: 21/06/2014, 18:20
ON A PERIODIC BOUNDARY VALUE PROBLEM FOR SECOND-ORDER LINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS S. pptx
... linear functional- differential equations, Arch Math (Brno) 33 (1997), no 3, 197–212 , Boundary Value Problems for Systems of Linear Functional Differential Equations, Folia Facultatis Scientiarium ... Kiguradze and B Puˇ a, On boundary value problems for systems of linear functional- differential equations, Czechoslovak Math J 47(122) (1997), no 2, 341–373 , On pe...
Ngày tải lên: 23/06/2014, 00:20
ON A BOUNDARY VALUE PROBLEM FOR NONLINEAR FUNCTIONAL DIFFERENTIAL EQUATIONS ROBERT HAKL Received 21 doc
... On a periodic-type boundary value problem for first-order nonlinear functional differential equations, Nonlinear Anal 51 (2002), no 3, 425–447 , On an antiperiodic type boundary value problem for ... 251–262 , Boundary Value Problems for Systems of Linear Functional Differential Equations, Folia Facultatis Scientiarium Naturalium Universitatis Masarykianae B...
Ngày tải lên: 23/06/2014, 00:20
Báo cáo toán học: "A Uniformly Distributed Statistic on a Class of Lattice Paths" doc
... Q as the first vertex strictly after P that lies weakly above LP rather than “that terminates a nonempty balanced subdiagonal subpath starting ˜ at P ” Then f is defined as f was This modification ... = B—and then no vertices actually get lowered Finally, delete P Figure gives an example of Case mAP < 1, Figure gives an example of Case mAP ≥ 1, and Figure gives the action of f on all p...
Ngày tải lên: 07/08/2014, 08:22
Báo cáo toán học: "On the h-Vector of a Lattice Path Matroid" pot
... [n + r] Recall that a subset T ⊆ k Ai is a partial transversal of A if there exists an injection φ : T → [k] such i=1 that t ∈ A (t) for all t ∈ T The partial transversals of A are the independent ... simplification of our original proof.) Let A, A, C, and Γ be as in Theorem 3.6, and set A+ = {a1 + 1, a2 + 1, , ar + 1} By Remark 3.5, the path A+ does not cross the...
Ngày tải lên: 08/08/2014, 01:20
Báo cáo toán học: "SIMWAL: A structural-functional model simulating single walnut tree growth in response to climate and pruning" docx
... Model inputs and data analysis Initial trees, input parameters and climate As far as possible, initial trees and input parameters in simulations were drawn from our experiments on living trees ... topological and geometrical characteristics, and parameters for the main processes), climate and soil data (at present air and soil temperatures, radiation, air VPD and air C...
Ngày tải lên: 08/08/2014, 14:22
ANTIFERROMAGNETIC HEISENBERG SPIN 1 2 MODEL ON a TRIANGULAR LATTICE IN a MAGNETIC FIELD
... ANTIFERROMAGNETIC HEISENBERG SPIN MODEL ON 14 9 II THE MODEL AND FORMALISM The antiferromagnetic Heisenberg model on a triangular lattice in the presence paper is described by the Hamiltonian: ... 21 4 433 [11 ] D J Farnell et al., J Physic Cond Matter 21 (20 09) 4060 02 [ 12 ] H C Jiang et al., Phys Rev B 79 (20 09) 20 409 (R) [13 ] D Heidarian, A Paramekant...
Ngày tải lên: 30/10/2015, 20:47
Markov functional model on a lattice
... Implementation of the Algorithms An Alternative Approach Conclusion 57 Bibliography 59 Appendix A Theorems and Results 62 Appendix B Data 65 iv Appendix C 67 Matlab Codes v Introduction The traditional ... Literature 1.1 1.2 1.3 Chapter Spot Rate Models HJM Model Market Rate Models 16 17 19 21 Markov- Functional Models 2.1 2.2 2.3 Chapter The Markov Process Caplets and Digital Caplet...
Ngày tải lên: 10/11/2015, 12:27