PH DEPENDENCE OF THE OPTICAL BIO SENSOR BASED ON DNA SEMICONDUCTOR GRAPHENE NANORIBBONS
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
... with my thesis ii ABSTRACT The main aim of this minor thesis is to evaluate the reliability of the final Achievement Computer-based MCQs Test for the 4th semester non- English majors at Hanoi University ... undertake this study entitled A study on the reliability of the final achievement Computer-based MCQs Test for the 4...
Ngày tải lên: 10/04/2013, 14:46
Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply
... simulation software EPANET to solve the optimal operation model of mixed-pump stations with the operating-mode adaptability The outlet flow QPi , j of each pump station is taken as the decision variable ... optimization is 3.84%, so the water supply requirement can be satisfied Fig.4 - The Outlet Flow for Each Pump Station of the First and Second Optimizati...
Ngày tải lên: 05/09/2013, 09:38
Tài liệu Báo cáo khóa học: Determination by electrospray mass spectrometry and 1H-NMR spectroscopy of primary structures of variously fucosylated neutral oligosaccharides based on the iso-lacto-N-octaose core doc
... produced by cone voltage fragmentation [14] The fragment ions of m/z 729 and m/z 544 are both from the monofucosylated D2b-5 ion m/z 1037 and not from the difucosylated D2b-5 ion m/z 1183 Thus the ... iLNO core structures and its variously fucosylated analogues, and to determine their anomeric configurations and linkages The proton chemical shifts of Ó FEBS 20...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction o...
Ngày tải lên: 07/03/2014, 06:20
Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements over the Pacific during TRACE-P pdf
... KEYWORDS: oxygenated organics, PANs, acetone Citation: Singh, H B., et al (2004), Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements ... showing the separation and detection of oxygenated organic species in ambient air aboard the NASA DC-8 during TRACE-P Some of these...
Ngày tải lên: 14/03/2014, 20:20
Temperature dependence of the quality of silicon nanowires produced over a titania supported gold catalyt
... both, the bare catalyst and the product may generate Raman bands, the spectra of a reference silicon wafer and that of the fresh catalyst are included in the figure The spectrum for the fresh catalyst ... quantitative comparison of the density of SiNW left on the catalyst surface after reaction at different temperatures, the Fig SEM micrograph of silicon nan...
Ngày tải lên: 16/03/2014, 15:09
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...
Ngày tải lên: 17/03/2014, 03:20
sensitivity properties of a novel no2 gas sensor based on mesoporous wo3 thin film
... Selected-area electron diffraction patterns recorded on mesoporous WO3 that is characteristic of diffuse electron diffraction rings demonstrate that the walls of our material are made up of nanocrystallite ... lead to excellent sensing properties upon exposure to low concentration of NO2 in air at low temperatures and enabled the selective detection of NO2 and H2 gases...
Ngày tải lên: 20/03/2014, 13:07
Báo cáo " The dependence of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices on concentration of impurities" pot
... transformation coefficient on concentration of impurities when concentration of impurities nD tend toward zero, value of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices ... of acoustic and optical phonons in doped superlattices depends non-linearly on concentration of impurities nD E...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
... during the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta ... were able to demonstrate that this was the case for both ADP and ATP–actin (not Fig Effect of pH on the interaction of actin with cofilin (A) Effect of pH on the interact...
Ngày tải lên: 31/03/2014, 09:20
Báo cáo sinh học: " Research Article Eigenvectors of the Discrete Fourier Transform Based on the Bilinear Transform" potx
... 31, 1982 [13] F A Gr¨ nbaum, The eigenvectors of the discrete Fourier u transform: a version of the Hermite functions,” Journal of Mathematical Analysis and Applications, vol 88, no 2, pp 355– ... value in the diagonal will not perturb the eigenvectors of the commuting matrix 3.2 Better Conditioned Bilinear Methods Bilinear transform can be considered as a tr...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx
... Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication of ... to fabricate a nanotube device on a cover glass and to investigate its applications Regarding the fabrication process of the nanotube FET sensor, chemical vapor deposition (CVD...
Ngày tải lên: 22/06/2014, 18:20
Báo cáo lâm nghiệp: "Specification of the beechwood soil environment based on chosen soil properties, aiming at the Fageta paupera habitat" docx
... information about the specific causation defining soils of Fageta paupera, on the contrary, the contribution to the knowledge of this ecosystem is in the determination of complicated soil environment, ... presence of herbs on the soil surface is primarily caused by the specificity of the soil environment After summarization of the computed values it...
Ngày tải lên: 07/08/2014, 10:21
research on fabrication and the physical properties of the multi-component ceramics based on pzt and the relaxor ferroelectric materials
... applications From the above fact, we have chosen dissertation topic is Research on fabrication and the physical properties of the multi-component ceramics based on PZT and the relaxor ferroelectric materials ... study the effect of Zr/Ti ratio in PZT on the structure, and the properties of the PZT - PZN - PMnN ceramics, determine...
Ngày tải lên: 04/12/2014, 02:54
Improvement in the design and operation of bio reactors and bio separators based on SMB technology
... Improvement in the Design and Operation of Bio- reactors and Bio- separators Based on SMB Technology Zhang Yan (M Eng., Tianjin University, P R C) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... stimulates the application of SMB technology in this field Therefore, this section will focus on the developments and applications of SMB in...
Ngày tải lên: 15/09/2015, 17:10