- Trang chủ >
- Khoa Học Tự Nhiên >
- Vật lý >
PH DEPENDENCE OF THE OPTICAL BIO SENSOR BASED ON DNA SEMICONDUCTOR GRAPHENE NANORIBBONS
A STUDY ON THE RELIABILITY OF THE FINAL ACHIEVEMENT COMPUTER-BASED MCQS TEST 1 FOR THE 4TH SEMESTER NON - ENGLISH MAJORS AT HANOI UNIVERSITY OF BUSINESS AND TECHNOLOGY
... with my thesis ii ABSTRACT The main aim of this minor thesis is to evaluate the reliability of the final Achievement Computer-based MCQs Test for the 4th semester non- English majors at Hanoi University ... undertake this study entitled A study on the reliability of the final achievement Computer-based MCQs Test for the 4th semester non- English majors at Hanoi University of Business and Technology ... TABLE OF CONTENT Chapter 1: INTRODUCTION 1. 1 Rationale for the study 1. 2 Aims and research questions 1. 3 Theoretical and practical significance of the study 1. 4 Scope of the study 1. 5 Method of the...
- 64
- 1,112
- 1
Analysis on the Optimal Dispatching of Mixed-pump Stations and the Operating-mode Adaptability Based on Safety Water Supply
... simulation software EPANET to solve the optimal operation model of mixed-pump stations with the operating-mode adaptability The outlet flow QPi , j of each pump station is taken as the decision variable ... optimization is 3.84%, so the water supply requirement can be satisfied Fig.4 - The Outlet Flow for Each Pump Station of the First and Second Optimization CONCLUSION The purpose of optimal operation ... operation scheme and the speed ratio of speed governing pump are determined to satisfy the dispatching commands, at the same time, to minimize the total consumption of all pump stations Therefore, the...
- 8
- 461
- 0
Tài liệu Báo cáo khóa học: Determination by electrospray mass spectrometry and 1H-NMR spectroscopy of primary structures of variously fucosylated neutral oligosaccharides based on the iso-lacto-N-octaose core doc
... produced by cone voltage fragmentation [14] The fragment ions of m/z 729 and m/z 544 are both from the monofucosylated D2b-5 ion m/z 1037 and not from the difucosylated D2b-5 ion m/z 1183 Thus the ... iLNO core structures and its variously fucosylated analogues, and to determine their anomeric configurations and linkages The proton chemical shifts of Ó FEBS 2004 Sequence determination of oligosaccharides ... previously as a core type [24] based on the identification of its fucosylated derivatives The monofucosylated iso-lacto-N-octaose, containing a Fuc at the first GlcNAc residue of the 6-branch forming...
- 15
- 576
- 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt
... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S3 Reaction ... following the decrease in A4 56 Data analysis Steady-state kinetic data were fitted with the Michaelis– Menten equation using nonlinear least-squares analysis incorporated into the origin software package...
- 9
- 327
- 0
Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements over the Pacific during TRACE-P pdf
... KEYWORDS: oxygenated organics, PANs, acetone Citation: Singh, H B., et al (2004), Analysis of the atmospheric distribution, sources, and sinks of oxygenated volatile organic chemicals based on measurements ... showing the separation and detection of oxygenated organic species in ambient air aboard the NASA DC-8 during TRACE-P Some of these measurements were duplicated using independent techniques and have ... ‘‘pollution filter’’ based on the lower two quartiles of the CO and C2Cl4 mixing ratios was employed to mitigate the effect of pollution Figure shows the CO mixing ratios as a function of latitude and...
- 20
- 540
- 0
Temperature dependence of the quality of silicon nanowires produced over a titania supported gold catalyt
... both, the bare catalyst and the product may generate Raman bands, the spectra of a reference silicon wafer and that of the fresh catalyst are included in the figure The spectrum for the fresh catalyst ... quantitative comparison of the density of SiNW left on the catalyst surface after reaction at different temperatures, the Fig SEM micrograph of silicon nanowires produced at 500 °C over a titania supported ... obtained at 300 °C gave a very weak Si signal, and overlapped with the spectra of the fresh catalyst, indicating a low yield of metallic Si Another interesting variation in the Raman was observed...
- 7
- 432
- 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC a Specific primers ... V a aspis, V a zinnikeri, and the remaining four clones having an intron D similar to that of the V am ammodytes ammodytin I1 gene All PLA2 genes contained a TAA stop codon, an AATAAA polyadenylation...
- 10
- 451
- 0
sensitivity properties of a novel no2 gas sensor based on mesoporous wo3 thin film
... Selected-area electron diffraction patterns recorded on mesoporous WO3 that is characteristic of diffuse electron diffraction rings demonstrate that the walls of our material are made up of nanocrystallite ... lead to excellent sensing properties upon exposure to low concentration of NO2 in air at low temperatures and enabled the selective detection of NO2 and H2 gases A high surface area and small ... Tainan, Taiwan, 2001 His major research has related to mesoporous materials, semiconductor gas sensor, and nanomaterials Min Hsiung Hon is a professor in the Department of Materials Science and Engineering...
- 7
- 499
- 0
Báo cáo " The dependence of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices on concentration of impurities" pot
... transformation coefficient on concentration of impurities when concentration of impurities nD tend toward zero, value of the parametric transformation coefficient of acoustic and optical phonons in doped superlattices ... of acoustic and optical phonons in doped superlattices depends non-linearly on concentration of impurities nD Especially, when concentration of impurities nD tend toward zero, value of the parametric ... [6-9] In order to improve the PRT theoretics for low-dimensional semiconductors, we, in the paper, examine dependence of the parametric transformation coefficient of acoustic and optical phonons in...
- 6
- 375
- 0
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
... during the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta ... were able to demonstrate that this was the case for both ADP and ATP–actin (not Fig Effect of pH on the interaction of actin with cofilin (A) Effect of pH on the interaction of RITC-actin with cofilin ... using a Varian MS 100 (Varian SA, Les Ulis, France), and a Pharmacia Ultraspec 2000 spectrophotometer For cofilin the absorbance was measured at 280 nm, where one absorbance unit is equivalent...
- 8
- 409
- 0
Báo cáo sinh học: " Research Article Eigenvectors of the Discrete Fourier Transform Based on the Bilinear Transform" potx
... 31, 1982 [13] F A Gr¨ nbaum, The eigenvectors of the discrete Fourier u transform: a version of the Hermite functions,” Journal of Mathematical Analysis and Applications, vol 88, no 2, pp 355– ... value in the diagonal will not perturb the eigenvectors of the commuting matrix 3.2 Better Conditioned Bilinear Methods Bilinear transform can be considered as a trapezoidal approach to the derivative ... together with the other methods Despite the fact that our method uses only the 14th order approximation, it is definitely better than these methods, even better than S400 Conclusions As the eigenvectors...
- 7
- 362
- 0
Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx
... Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication of ... to fabricate a nanotube device on a cover glass and to investigate its applications Regarding the fabrication process of the nanotube FET sensor, chemical vapor deposition (CVD) method has been ... spincoater Pairs of areas were fabricated in the PMMA film using photolithography and ordered pairs of electrode patterns were obtained (Fig 1a) A 1% APS solution was dropped on the substrate It was...
- 6
- 346
- 0
Báo cáo lâm nghiệp: "Specification of the beechwood soil environment based on chosen soil properties, aiming at the Fageta paupera habitat" docx
... information about the specific causation defining soils of Fageta paupera, on the contrary, the contribution to the knowledge of this ecosystem is in the determination of complicated soil environment, ... presence of herbs on the soil surface is primarily caused by the specificity of the soil environment After summarization of the computed values it is evident that the soils of Fageta paupera in the ... biotope Fageta paupera As a feature for soil assessment, soil conditions are used to explain the stability of soil environment or the measure of homogeneity of soil conditions within the entire soil...
- 7
- 324
- 0
research on fabrication and the physical properties of the multi-component ceramics based on pzt and the relaxor ferroelectric materials
... applications From the above fact, we have chosen dissertation topic is Research on fabrication and the physical properties of the multi-component ceramics based on PZT and the relaxor ferroelectric materials ... study the effect of Zr/Ti ratio in PZT on the structure, and the properties of the PZT - PZN - PMnN ceramics, determine PZT content which ceramics have good electrical properties and the relaxor ferroelectric ... physical properties of the multi-component ceramics based on PZT and the relaxor ferroelectric materials, Pb(Zn1/3Nb2/3)O3 and Pb(Mn1/3Nb2/3)O3 The results of the thesis will open up prospects for the...
- 52
- 341
- 0
Improvement in the design and operation of bio reactors and bio separators based on SMB technology
... Improvement in the Design and Operation of Bio- reactors and Bio- separators Based on SMB Technology Zhang Yan (M Eng., Tianjin University, P R C) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... stimulates the application of SMB technology in this field Therefore, this section will focus on the developments and applications of SMB in chiral separations In addition, recent applications of SMB technology ... Ma and Wang, 1997), most of these theories are based on the TMB model and have proved efficient in the design and optimization of SMB for linear system under ideal conditions only However, the...
- 236
- 350
- 0
Từ khóa: neuroanatomical dissection of the honey bee brain based on temporal and regional gene expression patternsanalytical thermal calculation of the heat exchange system based on the specific heat flux overall designmultilayer adsorption in binary liquid mixtures calculation of thermodynamical potential function profiles based on the lattice model f berger4 2 2 1 the energy and impact parameter dependence of the angle of deflectiontemperature dependence of the salting out parameters for equation 7 19temperature dependence of the salting out constants for individual ionsthe syllables that made up coordinated compound word are in equal relation in other words the meaning of coordinated compound word is more general than of each syllable and equally based on meaning of themdetermining the electronic and ionic conductivities from the activity dependence of the total conductivitycrystal structure of the low ph form of the vesicular stomatitis virus glycoprotein g187photo orientation and photo modulation of the optical thickness1 dependence of the mr signal on tr and tetopology and energy dependence of theperforatorflaps label a flap from the anterolateral thigh if based on a lateral circumflexfemoral lcf perforator of the vastus lateralis muscleperformance of the cea bio rad test for screening bsevalidation of the cea bio rad test by the european communitychuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngThơ nôm tứ tuyệt trào phúng hồ xuân hươngChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ