MOTT TRANSITION OF THE HALF FILLED HUBBARD MODEL IN a TWO DIMENSIONAL FRUSTRATED LATTICE

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

... tissue, (insets) CsA-treated Fabry (A, B) Heart – endothelial staining in Fabry mouse; (C, D) lung – epithelial cell staining increased in Fabry mouse; (E, F) brain microvascular endothelial staining ... Chiba Y, Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al (2002) Production in yeast of alpha-galactosidase A, a...

Ngày tải lên: 19/02/2014, 07:20

12 432 0
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt

... ootheca transport Ovarian BgVgR mRNA levels appeared high at the beginning of the last nymphal instar, steadily declining along the instar, and reaching the lowest values of the instar before the ... These included the insects D melanogaster (AAB60217), A gambiae (EAA06264), A aegypti (AAK15810), S invicta (AAP92450) and P americana (BAC02725), and the vertebrates Angu...

Ngày tải lên: 16/03/2014, 14:20

11 414 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was con...

Ngày tải lên: 23/03/2014, 17:21

7 384 1
Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

Báo cáo "Eliminating on the divergences of the photon self - energy diagram in (2+1) dimensional quantum electrodynamics " pot

... ¯ in the vicinity of the light cone, or (what is equivalent) such that the function ∆(p; m) in the momentum representation falls off sufficiently fast in the region of large |p| On the base of ... / VNU Journal of Science, Mathematics - Physics 23 (2007) 2 2-2 7 23 p k k p-k Figure The photon self- energy diagram Following the standard notation, th...

Ngày tải lên: 28/03/2014, 13:20

6 330 0
một số đặc điểm cấu tạo và sơ đồ tính toán cầu vòm ống thép nhồi bê tông (some structural features and calculating model of the concrete filled tubular arch bridge)

một số đặc điểm cấu tạo và sơ đồ tính toán cầu vòm ống thép nhồi bê tông (some structural features and calculating model of the concrete filled tubular arch bridge)

... ng thép nh i bê tơng ch u nén úng tâm Aa, Ac : di n tích m t c t ngang ng thép lõi bê tơng Ia, Ic : mơmen qn tính c a ti t di n ng thép ti t di n lõi bê tơng Ea, Ec : mơ un àn h i c a thép bê ... nhi u ng thép tròn c nh i bê tơng liên k t v i b ng b n thép (hình 5) ng thép c ch t o t thép t m theo ph ng pháp cu n tròn hàn d c ho c cu n d ng lò xo Hi u qu làm vi c c...

Ngày tải lên: 04/04/2014, 11:16

6 3,4K 12
variation of the germinable soil seed banks  in a pasture infested by parthenium hysterophorus l.at kilcoy, south-eastern queensland

variation of the germinable soil seed banks in a pasture infested by parthenium hysterophorus l.at kilcoy, south-eastern queensland

... East Asia, to certain Pacific Islands, to India, Pakistan, and Australia It has spread at an alarming rate achieving the status of a major weed within a relatively short period of time (Adkins ... (Coffin & Lauenroth 1989) The main objective of this study is to measure the size and temporal and spatial variation in the germinable seed bank of parthenium weed in...

Ngày tải lên: 19/06/2014, 11:35

100 313 0
báo cáo hóa học:" Validation of the Rasch-based Depression Screening in a large scale German general population sample" doc

báo cáo hóa học:" Validation of the Rasch-based Depression Screening in a large scale German general population sample" doc

... the manuscript MB participated in the analysis and interpretation of the data MW participated in the design of the study and the statistical analysis HG and EB participated in the design of the ... doi:10.1186/1477-7525-8-105 Cite this article as: Forkmann et al.: Validation of the Rasch-based Depression Screening in a large scale German gene...

Ngày tải lên: 20/06/2014, 16:20

8 544 0
Báo cáo lâm nghiệp: "Effect of leaf biomass and phenological structure of the canopy on plot growth in a deciduous hardwood forest in northern Japan" pot

Báo cáo lâm nghiệp: "Effect of leaf biomass and phenological structure of the canopy on plot growth in a deciduous hardwood forest in northern Japan" pot

... Annual leaf biomass was calculated by summing monthly leaffall To quantify the phenological pattern of leaffall and the corresponding phenological structure of the canopy, annual leaf biomass was ... 726 M Takiya et al Table I Stem number and basal area in the study plots Thinning was performed in 1984 Values (stem number and basal area just before and aft...

Ngày tải lên: 07/08/2014, 16:20

8 347 0
Báo cáo khao học: "Dominance of the mycorrhizal fungus Rhizopogon rubescens in a plantation of Pinus pinea seedlings inoculated with Suillus collinitus" ppsx

Báo cáo khao học: "Dominance of the mycorrhizal fungus Rhizopogon rubescens in a plantation of Pinus pinea seedlings inoculated with Suillus collinitus" ppsx

... TTT.GAGATA AAAGTTA.TT TTCCGAGATA AAAGTTAATT TCT.GAGATA AAAGTTAATT 300 CGCATCGATG AAGAACGCAG CGCATCGATG AAGAACGCAG CGCATCGATG AAGAACGCAG 350 TCTACAGTGA ATCATCGAAT TCTACAGTGA ATCATCGAAT TCTACAGTGA ATCATCGAAT ... TCCTTGA CTCGGG.CTC 550 TCGACTTTGC GCGACAAGGC TCGACTTTGC GCGACAAGGC TCGACTTTGC GCGACAAGGC 600 AAGCGCATGA ATGAAG.GTT AAGCGCATGA ATGAAG.GTT AAGCGCACGA ATGAAATGTT 650 CTTCCGAGAG AAAACGTCTT...

Ngày tải lên: 08/08/2014, 14:20

8 267 0
Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc

Báo cáo khoa học: "Measurement and modelling of the photosynthetically active radiation transmitted in a canopy of maritime pine P Hassika" doc

... measurements of the PAR reflectance of the canopy and the understorey is presented in figure The increase in the canopy PAR reflectance at the beginning and at the end of the day is due to the interception ... forest of maritime pines The daily variations of the incident and transmitted PAR were presented increase in the canopy PAR obser...

Ngày tải lên: 09/08/2014, 04:20

16 299 0
Báo cáo y học: ":Evaluation of the Patient Acceptable Symptom State in a pooled analysis of two multicentre, randomised, double-blind, placebo-controlled studies evaluating lumiracoxib and celecoxib in patients with osteoarthritis" pptx

Báo cáo y học: ":Evaluation of the Patient Acceptable Symptom State in a pooled analysis of two multicentre, randomised, double-blind, placebo-controlled studies evaluating lumiracoxib and celecoxib in patients with osteoarthritis" pptx

... to PASS during and at the end of the study period and on patient achievement of sustained satisfaction by PASS Materials and methods A pooled analysis of data taken from two international, multicentre, ... and WOMAC™ LK 3.1 Function – was originally estimated using the least square means obtained from an analysis of covariance with study and baseline va...

Ngày tải lên: 09/08/2014, 10:20

11 456 0
Báo cáo y học: " A cross-sectional testing of The Iowa Personality Disorder Screen in a psychiatric outpatient setting" pot

Báo cáo y học: " A cross-sectional testing of The Iowa Personality Disorder Screen in a psychiatric outpatient setting" pot

... PDs in bivariate analysis A new finding is that only the IPDS score remained significant in the multivariate analysis Our interpretation of these results is that psychological and functional variables ... statistical analyses and helped to draft the manuscript AAD participated in the design, performed statistical analyses and helped to draft the manuscript of the study...

Ngày tải lên: 11/08/2014, 15:22

8 332 0
Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx

Báo cáo y học: " Simultaneous monteggia type I fracture equivalent with ipsilateral fracture of the distal radius and ulna in a child: a case report" docx

... include: type III Monteggia injury with ipsilateral distal radius and ulna fractures [2]; olecranon fracture and distal radial epiphysis [3]; type II Monteggia fracture with fracture separation ... separation of the distal radial physis [4]; type IV Monteggia injury with distal diaphyseal fracture of the radius [5]; 11 cases of Monteggi...

Ngày tải lên: 11/08/2014, 21:22

4 338 0
Báo cáo y học: " Evolution of the uniquely adaptable lentiviral envelope in a natural reservoir host" potx

Báo cáo y học: " Evolution of the uniquely adaptable lentiviral envelope in a natural reservoir host" potx

... within a single animal can vary by greater than 35% at the aa level The ranges of aa diversity in some intra-host pairwise SIVsm V1V2 sequence comparisons in this study rival that of inter-animal ... glycosylated in naturally infected SMs Presumably, continually evolving antibody responses in these natural hosts maintain a highly glycosylated surface protein, albeit with...

Ngày tải lên: 13/08/2014, 09:21

14 265 0
Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx

Báo cáo y học: " Changes in the central component of the hypothalamus-pituitary-thyroid axis in a rabbit model of prolonged critical illness" ppsx

... 5'-GAACAACATGCATTCCGAGAAG-3' Forward: 5'-GCGCAGCGCGTTGAA-3' Probe: 5'-AACGAACAGTCATCACCACATCTCATCCAG-3' Reverse: 5'-GGATGGAGCTCGTCCAAGTG-3' Forward: 5'-GCCATCCTGACTATTTCACTGAAGA-3' Probe: 5'-AAGCCTACTTTTTCTCAAGGGCAGTCACCG-3' ... was therefore used as an internal control Statistical analysis All statistical analyses were done using StatView software (SAS Institute Inc., Cary, NC, USA) Data wer...

Ngày tải lên: 13/08/2014, 19:20

10 378 0
w