... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTT...
Ngày tải lên: 14/02/2014, 14:20
... 2002 Aromatic stacking in API (Eur J Biochem 269) 4153 Fig Stick models of the reactive site in bovine trypsin and API The catalytic triad residues of trypsin and API are Ser195–His57– Asp102 and ... because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspar...
Ngày tải lên: 21/02/2014, 03:20
Đề tài " Constrained steepest descent in the 2-Wasserstein metric " ppt
... as easily as in the unconstrained case The same difficulty arises in the determination of the geodesics in Eu,θ We build on previous work on the geometry of P in the 2-Wasserstein metric, and Section ... of Mathematics, 157 (2003), 807–846 Constrained steepest descent in the 2-Wasserstein metric By E A Carlen and W Gangbo* Abstract We study several constrai...
Ngày tải lên: 22/03/2014, 15:21
Báo cáo khoa học: Protein kinase Ch activity is involved in the 2,3,7,8tetrachlorodibenzo-p-dioxin-induced signal transduction pathway leading to apoptosis in L-MAT, a human lymphoblastic T-cell line potx
... explained by the single AhR pathway The molecular mechanism involved in the AhR-independent pathway( s) leading to TCDDinduced immunotoxicity is not clearly understood, and indeed the lack of a ... PKCh and specifically sup906 press its kinase activity To confirm that PKCh kinase activity really does participate in the signal transduction mechanism invo...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Calpain 1–titin interactions concentrate calpain 1 in the Z-band edges and in the N2-line region within the skeletal myofibril doc
... 60 -2 13 18 23 25 14 24 34 44 54 205 18 5 16 5 14 5 12 5 10 5 85 65 45 -6 25 81 Calpain 1 titin interactions in myofibrils F Raynaud et al Fig Calpain and calcium localization in freshly excised and stored ... at the edges of the structure Calpain 1 titin interactions in myofibrils These data pointed out a localization of calpain in bovine skeletal...
Ngày tải lên: 23/03/2014, 13:20
Executing SQL over Encrypted Data in the Database-Service-Provider Model pptx
... Pfr R )#a6W&6@G@'f8 S '#QPA{P'u ! " $ ( $ ( â ( F " " â F " 2.4 Storing Encrypted Data y 2.3 Mapping Functions 2.2 Identication Functions  y X Ê( &6s6( ( " #'&6s6a@'df#%#6( ... l7&'&fP'c&6)a#hW&6)#a&'6Y1B ( â H " H F " t ! $ " " ( ! " $ $ F ( IMPLEMENTING RELATIONAL OPERATORS OVER ENCRYPTED RELATIONS F ! F y ( " H ! " F ( G9vPv#&...
Ngày tải lên: 30/03/2014, 13:20
RESEARCH, DESIGN AND FABRICATION OF DIGITAL INFORMATION TRANSIMITER WORKING IN THE VHF BAND
... Vietnam, information transceiver system working VHF bands have a lot of important applications Therefore, the study of information transceiver systems in the band VHF to understand the structure, the ... buildings can be a problem in urban areas 1.3 Thesis objectives and structure In this thesis,I will clarify the roles and the need of a information...
Ngày tải lên: 27/05/2014, 20:57
Economic Transitions In The Arab World pptx
... Cataloging -in- Publication Data After the spring: economic transitions in the Arab world I Magdi Am in [et al.] p em Includes index ISBN 978- - 1.9- 992492- (doth : alk paper) Arab countries- Economic ... the Arab Spring brings to mind similar periods in other regions-southern Europe in the 1970s, Latin America in the 1980s, eastern Europe in the 1990s-...
Ngày tải lên: 28/06/2014, 17:20
Báo cáo y học: "β Treatment with recombinant interferon-β reduces inflammation and slows cartilage destruction in the collagen-induced arthritis model of rheumatoid arthritis" ppt
... Recently, the presence of IL-18 in RA synovium and its role in the development and maintenance of inflammatory arthritis have been shown [26] To determine whether alterations in the expression of these ... Bijlsma JW: Synergistic activity of interleukin-4 and interleukin-10 in suppression of inflammation and joint destruction in rheumatoid arthritis...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: " Protective effect of vasoactive intestinal peptide on bone destruction in the collagen-induced arthritis model of rheumatoid arthritis" pptx
... mice, and may account for the bone protective properties of VIP in RA On the other hand, its effects on the expression of OPG further support the postulated bone protective property of VIP This ... osteoclastogenic actions of RANKL Excessive production of RANKL and/or a deficiency of OPG could, therefore, contribute to the increased bone resorption typifi...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "Hepatocyte growth factor ameliorates dermal sclerosis in the tight-skin mouse model of scleroderma" doc
... reduction of hypodermal thickness, including the subcutaneous connective tissue layer (Figure 2) Skin fibrosis was assessed quantitatively by measuring hypodermal thickness The hypodermal thickness of ... T: Simultaneous or delayed administration of hepatocyte growth factor equally represses the fibrotic changes in murine lung injury induced by bleomycin A morphologic study...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "A comparison of low-dose risperidone to paroxetine in the treatment of panic attacks: a randomized, single-blind study" ppsx
... for the treatment of panic attacks was warranted We describe herein an exploratory, randomized, single-blind trial of risperidone versus paroxetine for the treatment of panic attacks We hypothesized ... for analysis • The Hamilton Anxiety Rating Scale (HAM -A) [47] The Ham -A is a 14 item clinician-rated measure, which assesses symptoms of anxiety The Ham...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo sinh học: "AAV-mediated gene therapy for metabolic diseases: dosage and reapplication studies in the molybdenum cofactor deficiency model" pps
... the animals obtained a single intravenous tail vein injection containing various amounts of AAV-MOCS1 in phosphate-buffered saline First, we investigated the effect of a thirty-fold reduced dosage ... AAV-MOCS1 represents a borderline result and indicates a range for the minimal dosage required for abolishing the MoCo deficiency phenotype With a maximum body weight of 40...
Ngày tải lên: 14/08/2014, 19:22
Role of SPHK2S1P signalling in regulating mitochondrial function in the MPTP induced mouse model of parkinsons disease and in the MPP treated MN9D cells
... Possible role of sphingosine kinase 2/S1P signaling in promoting mitochondrial function in the MPTPinduced mouse model of Parkinson’s disease and in MPP+ - treated MN9D cells (Manuscript in Press) in ... changes observed in the MPTP- induced mouse model of Parkinson’s disease 102 4.2 Expression pattern of TH and DAT in the MPTP in...
Ngày tải lên: 09/09/2015, 08:12