... S + C + B At time t = we • sell one put option for P0 (write the put option) • sell one share for S0 (short position) • buy one call option for C0 • buy one bond for B0 = P0 + S0 − C0 > Ee −rT ... S + C + B At time t = we • sell one put option for P0 (write the put option) • sell one share for S0 (short position) • buy one call option for C0 • buy one bond for B0 = P0 + S0 −...
Ngày tải lên: 29/10/2013, 18:05
... to focus on finding the difficulties in studying TOEIC Reading of non English majors at elementary level at Haiphong Private University and some implications while teaching and studying this ... Chapter 2: A study on the difficulties in studying TOEIC Reading of non- English majors students at elementary level at Haiphong...
Ngày tải lên: 11/12/2013, 23:53
Tài liệu A Dissertation on the Medical Properties and Injurious Effects of the Habitual Use of Tobacco pptx
... ***** A DISSERTATION ON THE MEDICAL PROPERTIES AND INJURIOUS EFFECT OF THE HABITUAL USE OF TOBACCO: READ, ACCORDING TO APPOINTMENT, BEFORE THE MEDICAL SOCIETY OF THE COUNTY OF ONEIDA, AT THEIR ... consumers, and why the candid among them acknowledge that these evils arise from its use? The health of the medical gentleman above named was materi...
Ngày tải lên: 17/02/2014, 22:20
the effect of monetary incentive on effort and task performance a study of vietnamese company
... provide a theoretical framework on the basic concepts and theories involved in monetary incentive in task and effort performance of managers and accountants There are not many things as monetary incentive ... companies use money to motivate managers and accountants on effort and task performance? What happens if monetary incentives are not parallel w...
Ngày tải lên: 13/03/2014, 14:20
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
... co-digestion A synthetic linker (complementary oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to ... of adenosine 5¢-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: "Empirical Lower Bounds on the Complexity of Translational Equivalence ∗" pdf
... every word on one side linked to every word on the other side), then we added links from each of these words to NULL Second, if n words on one side of the bitext aligned to m words on the other side ... bilingual constituents: The span of every node in the constraining parse tree must coincide with the relevant monolingual span of some 979 S NP the function word...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: "Estimating Upper and Lower Bounds on the Performance of Word-Sense Disambiguation Programs" docx
... Upper and Lower Bounds 5.1 Lower Bounds W e could be in a better position to address the question o f the relative difficulty of interest if we could establish a rough estimate of the upper and ... lower bounds on the level of performance that can be expected W e will estimate the lower bound by evaluating the performance of a straw man system,...
Ngày tải lên: 17/03/2014, 08:20
Accompanying the document Proposal for a REGULATION OF THE EUROPEAN PARLIAMENT AND OF THE COUNCIL on European Social Entrepreneurship Funds doc
... practices for social businesses or the creation of a database for existing labels and certifications of social enterprises, to measures aiming to strengthen the professionalism and managerial capacities ... Employment, Social Affairs and Inclusion, Health and Consumer Protection, Internal Market and Services, Taxation and Customs Union, the Secretariat Genera...
Ngày tải lên: 30/03/2014, 12:20
STUDENTS’ SATISFACTION ON THE SERVICE QUALITY PROVIDED BY COLLEGES OF THAI NGUYEN UNIVERSITY: A PROPOSED FORMATION PROGRAM
... separate constructs Finally, Zeithaml et al (2009) saw satisfaction as a broader concept than service quality, suggesting that service quality was a component of satisfaction In total we can ... professional demanding practice These limitations can be a major influence on student satisfaction of services and the quality of training as well as the college's rep...
Ngày tải lên: 13/05/2014, 14:45
Báo cáo khoa học:Bounds on the Tur´n density of PG(3, 2) a pot
... perfect matching 2n−1 + edges, then G contains a The automorphism group of PG(2, 2) acts transitively on the lines of PG(2, 2) and also, acts transitively on the 3-subsets of PG(2, 2) that are not ... containing u a Fano plane, J Combin Theory Ser B, 78(2000), 274-276 [2] P Keevash, B Sudakov, The exact Tur´n number of the Fano plane, Combinatorica, a to ap...
Ngày tải lên: 07/08/2014, 08:20
Báo cáo toán hoc:"A New Lower Bound on the Density of Vertex Identifying Codes for the Infinit" doc
... Proposition The density of every vertex identifying code for the infinite hexagonal grid is at least 2/5 Proof: Our proof is by the discharging method Thus, D must contain at least 2/5 of the vertices ... elsewhere Theorem The density of every vertex identifying code for the infinite hexagonal grid is at least 12/29 Proof: Our proof is by discharging We assign...
Ngày tải lên: 08/08/2014, 01:20
Báo cáo toán học: "Lower Bounds for the Average Genus of a CF-graph" doc
... subgraph of Gi+1 for all i In [4] it was proved that the values of the average genus for 2-connected graphs have limit points Note that the average genus for bar-amalgamation of a cactus and the ... number of graphs in the sequence can be obtained by attaching ears serially or by bar-amalgamation of a cactus to GN Proof Suppose the values of the av...
Ngày tải lên: 08/08/2014, 12:23
Báo cáo y học: "Left ventricular diastolic dysfunction of the cardiac surgery patient; a point of view for the cardiac surgeon and cardio-anesthesiologist" pptx
... coronary artery bypass grafting [48,49] In a similar way, Yamamoto et al by using classical ECHO after coronary artery bypass grafting, showed that DD was characterized by a decrease in E wave ... DD through an increase upon wall thickness (secondary to enlargement of cardiac myocytes), and changes in the vasculature, the diameter, and vascular stiffness of the aorta and...
Ngày tải lên: 10/08/2014, 10:20
Lower bounds for the integration error for multivariate functions with mixed smoothness and optimal Fibonacci cubature for functions on the square
... in this case The proof is complete 3.3 Integration of non-periodic functions The problem of the optimal numerical integration of non-periodic functions is more involved The cubature formula below ... Thus, the optimal integration error decays as quickly as in the univariate case In fact, this represents one of the motivations to consider the third index θ Unf...
Ngày tải lên: 14/10/2015, 15:32
LOWER BOUNDS ON THE KOBAYASHI METRIC NEAR A POINT OF INFINITE TYPE
... |Dρ| ≈ That is the proof of property (v) KOBAYASHI METRIC NEAR A POINT OF INFINITE TYPE 11 The proof of Theorem 2.1 is complete Proof of Theorem 1.2 The proof of Theorem 1.2 follows immediately ... David W Catlin Estimates of invariant metrics on pseudoconvex domains of dimension two Math Z., 200(3):429–466, 1989 Sanghyun Cho A lower bound on the K...
Ngày tải lên: 26/10/2015, 14:04