Identification and characterization of short vegetative phase (SVP) target genes

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...

Ngày tải lên: 23/03/2014, 21:20

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...

Ngày tải lên: 20/06/2014, 07:20

... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...

Ngày tải lên: 21/06/2014, 05:20

... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...

Ngày tải lên: 06/08/2014, 18:20

... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS partic...

Ngày tải lên: 09/08/2014, 08:22

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM...

Ngày tải lên: 11/08/2014, 11:21

... as: Xin et al.: Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing ... response to biotic and/ or abiotic stresses in wheat Results Identification of powdery mildew infection and heat stress responsive...

Ngày tải lên: 11/08/2014, 11:21

... Page of 15 Figure Expression profiles of Actinidia flowering genes in mature plant organs Real-time RT-PCR analysis of the Actinidia flowering genes in the root, stem internode, leaf, flower and ... Figure Expression profiles of Actinidia flowering genes in normal and aberrant flowers Real-time RT-PCR analysis of the Actinidia flowering genes in the lea...

Ngày tải lên: 11/08/2014, 11:22

... important for ATP binding, has no kinase activity [13] To examine whether purified GST-AtHaspin has kinase activity, an in vitro kinase assay was performed using purified GST-AtHaspin and GST-AtHaspin ... Dlk/ZIP kinase orthologues, and thus, AtHaspin has an additional role as a H3 Thr11 kinase in A thaliana Phosphorylation of histone H3 at Thr3 and Thr11 Mitotic...

Ngày tải lên: 11/08/2014, 11:22

... flowering phenotype of the soc1 mutant and the mutation of AGL24 suppresses the early flowering of overexpression of SOC1, indicating that AGL24 is one of the downstream target genes of SOC1 (Yu et ... repressors of the GA pathway in the control of flowering time These genes also participate in feedback-control of GA biosynthesis SPY is another repressor of the GA pathway,...

Ngày tải lên: 11/09/2015, 09:57

... function of most of the J-domain proteins remains to be elucidated The function of several known J-domain proteins will be discussed in detail in section 1.5 29 1.5 Function of J-domain proteins during ... J-domain proteins in the Arabidopsis genome (Rajan and D'Silva, 2009) These J-domain proteins are classified into four distinct groups Type I J-domain proteins...

Ngày tải lên: 11/09/2015, 10:02

... flowering mainly under short days, converges with the photoperiod pathway at the level of LFY transcription control (Parcy, 2005) 1.6 SHORT VEGETATIVE PHASE (SVP) SHORT VEGETATIVE PHASE (SVP), which encodes ... that other target genes of SVP exist, besides FT and SOC1, in control of flowering Therefore, in this study, we investigated target genes of SVP...

Ngày tải lên: 22/10/2015, 21:20