... purpose The separate data area of these database systems means that they not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space The space occupied by the log in a database system ... log as the most up to date ‘‘truth’’ about the state of the data on disk The main difference is that database systems not use the log as the final repositor...
Ngày tải lên: 12/09/2012, 15:05
... modify a page of data at a time An attempt by a reader to write previously read data causes a memory fault which converts a reader into a writer and invalidates all other page caches A subsequent attempt ... when it initiates a cache replacement A data manager may restrict the use of cached data by issuing a pager_data_lock request, specifying the types of ac...
Ngày tải lên: 12/09/2012, 15:05
Tài liệu A Knowledge Management System for ERP Implementation pdf
... stage To accomplish this, Table summarizes the KM practices in ERP implementation process A KNOWLEDGE MANAGEMENT SYSTEM FOR ERP IMPLEMENTATION Knowledge management systems (KMS) refer to a class ... The ERP change in China: a resourcebase perspective Information Systems Journal 14: 153– 167 Jarrar Y 2002 Knowledge management: learning for organizational experi...
Ngày tải lên: 16/01/2014, 16:33
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...
Ngày tải lên: 16/03/2014, 01:20
The Design and Implementation of a Sequence Database System * docx
... supports relational data as well as sequencedata, using a novel design paradigm of enhancedabstractdata types (BADTs ) The systemimplementation basedon this paradigmallows sequence relational queriesto ... PIVceeding of the ACM SIGMOD Conference on Management of Data, May 1994 [CS92] RakeshChandmand Arie Segev.ManagingTemporalFinancial Data in anExtensible Database. In Procee...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Ishihara et al (Eur J Biochem 270) Here we examined the effects of SA on stress response in mammalian cells using a simple screening system, and revealed that SA is a potent Hsp inducer in mammalian ... expression of endogenous heat shock proteins such as Hsp1 0 5a and Hsp7 0 in various mammalian cells Enhancement of thermoresistance of cells...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 201...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc
... directly comparable work on subcategorization acquisition for French is (Chesley and Salmon-Alt, 2006) who propose a method for acquiring SCFs from a multi-genre corpus in French Their work relies ... introduced a system which we have developed for acquiring large subcategorization lexicons for French verbs When the system was applied to a large French newspaper corp...
Ngày tải lên: 31/03/2014, 00:20
Development of a liposomal nanodelivery system for nevirapine ppsx
... was added and placed on a carbon coated grid The excess water was absorbed using a filter paper and uranyl acetate stain was added The grid was then washed with water to remove excess uranyl acetate ... atazanavir, by a human brain endothelial cell line Pharm Res 2008, 25:2262-2271 30 Kaur A, Jain S, Tiwary AK: Mannan-coated gelatine nanoparticles for sustained and targeted delivery...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Validation of a microwave radar system for the monitoring of locomotor activity in mic pptx
... 12 mice housed individually in standard breeding cages Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automatically by means of microwave ... parameters of locomotor activity Conclusion The aim of this study was to develop an apparatus consisting of a battery of radar sensors to allow th...
Ngày tải lên: 10/08/2014, 09:20
báo cáo khoa học: "Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol" pptx
... this article as: Cabassa et al.: Collaborative planning approach to inform the implementation of a healthcare manager intervention for hispanics with serious mental illness: a study protocol Implementation ... is appropriate and essential to increase applicability to the target population SWs are a natural fit for the CM role because they [1...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
... article as: Hermenau et al.: Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional ... (range - 16) at t1 and M = 9.16 years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphan...
Ngày tải lên: 13/08/2014, 18:22
Design and development of a CMOS power amplifier for digital applications
... that make it acts as an open circuit and also the tank circuit appears to be a Design and Development of a CMOS Power Amplifier for Digital Applications 34 CHAPTER 3: Fundamentals of Power Amplifier ... Scattering Design and Development of a CMOS Power Amplifier for Digital Applications 40 CHAPTER 4: Power Amplifier: Design Implementa...
Ngày tải lên: 04/10/2015, 10:25
Implementation of a drug discovery tool for the evaluation of anti fibrotic compounds application in fibrovascular disorders
... salt Graduate Program in Bioengineering 22 Chapter Literature Review DexS has a widespread application in medical industry as an anti- coagulant agent and as ingredients of cream and ointment for ... was trypsinized and replated at a ratio of 1:5 Trypsinization was performed by incubating the cells in a minimal amount (1ml for T-75 flask) of Trypsin-EDTA (1x) for...
Ngày tải lên: 09/10/2015, 11:07
IC implementation of a bioelectric acquisition system for medical application
... electronic devices Figure 1.1: Overview of the bioelectric acquisition system The bioelectric signal acquisition system for medical application usually consists of the transducer, followed by an instrumentation ... for medical applications and a few major bioelectric signals are shown in Table 1.1 As seen from the table, these signals typically are in the range...
Ngày tải lên: 22/10/2015, 21:19