How does the institutional environment affect the formation of political connections
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural rearrangement of the yeast bc1 complex that finally ... context of macromolecular organization of the mitochondrial proteome, comparatively little is known about the assembly pathway leading to the maturation of the cytochrome bc1 complex in the inner mitochondrial...
- 15
- 639
- 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may benefit from the way in which the las operon ... upstream to the las operon The plasmid pLB85 harbouring attP of TP901-1 and a promotorless gusA gene encoding b-glucuronidase [21] was used as plasmid vector for site-specific integration of extra gene...
- 12
- 616
- 0
Tài liệu The Formation of Christendom, Volume VI pdf
... the Saviour with the guardianship of the Vine" But the Vine in the universal language of the Fathers betokened the whole Church of God And the Council refers the confirmation of its acts to the ... edition As these works are indicated in the notes as they occur with the single name of the author, I have given here their full titles The present volume is the sixth of the Formation of Christendom, ... Letter of the bishop of Vienne to the Roman senate upon this Council, 139 The cause of the Bishop of Rome is not that of one bishop, but of the Episcopate itself, 140 Words of Ennodius, bishop of...
- 168
- 375
- 0
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic domain, ... types of homodimers The insert within the catalytic domain is of importance for complex formation No functional significance has previously been ascribed to the insert between Asp and His of the ... to the catalytic His264, and the proximity to the active site may explain the effect of oligomerization on enzyme activity Even though the exact mechanism for complex formation and activation of...
- 6
- 520
- 0
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... calculated and reported, such as the average a4v in each hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... set of 23 well-known amyloidogenic proteins and (c) guidance towards applying this software as a useful tool for improving the solubility of recombinant proteins and for controlling the formation ... there are three scales which allow the prediction of amyloidogenic regions in a protein sequence (or rather, the ability of a peptide to be amyloidogenic): the scale of the packing density, and...
- 8
- 415
- 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc
... enzymatic assays using human and porcine P450c17 in the presence of various substrates – preg, 17aOHpreg and DHEA – and analyzed androstadienol formation from each substrate As observed in Fig ... its activity increasing to 15% of preg transformation while the activity of human P450c17 increases to 12% These results show that human and porcine P450c17 have similar catalytic activities and ... 3, the biosynthesis of androstadienol in humans (A) and pigs (B) does not require prior formation of 1 7a- OH-preg and DHEA The lack of androstadienol synthesis in the presence of lM of ketoconazole...
- 7
- 612
- 0
How and Why does the Efficiency of Regional Innovation Systems Differ? doc
... indication of the quality, particularly the efficiency and workability of the national, regional or industry-specific innovation system The figures for the average number of new products and patents ... cooperation behavior and the efficiency of innovation activities, Figures and show the combinations of two dummy variables for the propensity to cooperate on R&D and indicators for the regional output ... input The elasticity should increase as the quality of inputs to the R&D process improves and the spillovers stemming from the R&D activities of other actors in the region become more pronounced The...
- 26
- 408
- 0
Báo cáo Y học: Introducing Wilson disease mutations into the zinc-transporting P-type ATPase ofEscherichia coli The mutation P634L in theÔhingeÕ motif (GDGXNDXP) perturbs the formation of the E2P state pdf
... deviation of three to four measurements In addition to measuring the formation of aspartyl phosphate, the catalytic cycle of a P-type ATPase can be characterized by determining the decay rate of the ... changes in Mg2+ ligation so that in the E1 state Mg2+ is ligated by residues in the hinge motif in the P domain and by residues in the N domain, whereas in the E2 state the latter are replaced by residues ... Dephosphorylation assays The rate of dephosphorylation of the phosphoenzyme intermediate was determined both in the absence of ADP (dephosphorylation via the E2P intermediate) and in the presence of...
- 8
- 500
- 0
The formation of the plural noun in English and Vietnamese equivalents
... compare the differences between the formation of plural nouns in English and in Vietnamese 36 Chapter two :The formation of plural nouns in English and Vietnamese equivalents In English, the English ... reference books and on the internet to select the valuable information relating to the theme the forming of the plural nouns in English and Vietnamese equivalents Therefore, the content of the study ... similarities and the differences between the ways of the formation of plural nouns and I hope that the study will help English learners know about the formation of the plural nouns in English and Vietnamese...
- 77
- 733
- 3
Báo cáo khoa học: Cupiennin 1a, an antimicrobial peptide from the venom of the neotropical wandering spider Cupiennius salei, also inhibits the formation of nitric oxide by neuronal nitric oxide synthase pptx
... hydrophobic anchors Given the length of the first helix of cupiennin 1a, and the number of hydrophobic anchors available, it seems likely that the cupiennin 1a ⁄ Ca2+-CaM complex is analogous to the structure ... that cupiennin 1a also complexes with Ca2+-CaM, and is one of the more active of the known peptide inhibitors of nNOS Cupiennin 1a from Cupiennius salei Results Cupiennin 1a was tested for the ... this peptide showed some structural features in common with certain amphibian peptides that inhibit the formation of NO by neuronal nitric oxide synthase (nNOS) [10] These particular amphibian peptides...
- 7
- 366
- 0
How does the gambling affect the society? ppsx
... in the state will go to pieces And gambling is condemned for the same reason; because the effect of gambling is injurious, not only to the individuals, but to public social life The evils of gambling ... comparison of gambling and dueling will help us to see why gambling is an evil In a duel, as in a game of chance, both parties willingly agree to run a risk In gambling they risk the loss of their money; ... other, that is their own private affair Why should the law stop them? The answer is that it is not their own private affair It is a public affair; because, if every citizen can take the law into...
- 5
- 271
- 0
How does the philosophy of Government affect public policy?
... like the concept of European and American scholars; public also means the State, the Government From the definitions of Government and public policy, we can see that the Government or the philosophy ... opposition of the people with that policy decides the existence of the policy, even the existence of the Government (the coup in Thailand occurred due to military discontent with the Government s ... the use of those given rights, if necessary, they will reclaim, not give the rights to use it CONCLUSION In short, the philosophy of the Government decides the existence or non-existence of public...
- 6
- 656
- 0
How does the philosophy of Government affect public policy?
... like the concept of European and American scholars; public also means the State, the Government From the definitions of Government and public policy, we can see that the Government or the philosophy ... opposition of the people with that policy decides the existence of the policy, even the existence of the Government (the coup in Thailand occurred due to military discontent with the Government s ... in the use of those given rights, if necessary, they will reclaim, not give the rights to use it CONCLUSION In short, the philosophy of the Government decides the existence or nonexistence of public...
- 7
- 472
- 1
How does bovine serum albumin prevent the formation of kidney stone a kinetics study
... nucleation model, to examine the nucleation of Calcium Oxalate Monohydrate and the impact of IV bovine serum albumin (BSA) In addition, we also examine how the BSA influences the assembly of CaOx ... further study of the role of albumin on the CaOx crystal crystallization leading to an effective approach to control the formation of CaOx crystals, and contribute to the treatment of kidney stones ... SUMMARY Calcium oxalate monohydrate is the main inorganic constituent of kidney stones Thus, the study of calcium oxalate (CaOx) crystal formation is of major importance for human health Urinary...
- 91
- 238
- 0
How does the institutional environment affect the formation of political connections
... under-examined: How does institutional environment affect the formation of firms’ various political connections? In light of the institutional theory and social network perspective, I argue that how institutional ... hypotheses: The effects of the status quo and the credibility of institutions on the formation of political connections are contingent on the types of institutions as well as the types of political ... Table shows the results regarding how the institutional status quo and the credibility of property rights institutions affect the formation of two forms of political connections Model is the baseline...
- 57
- 236
- 0
Từ khóa: how does the size of a vibrating surface affect the pitch of its soundhow does the ratio of two dyes in a mixture affect its colorhow does the degree of stretching affect the ability of plastic food wraps to keep foods freshhow does the texture of paper affect its printing qualityhow does the volume of background music affect short term memoryhow does the amount of water in a gel affect its flexibilityhow does the law of conservation of mass and energy apply to chemical equationshow does the law of conservation of matter and energy apply to nuclear reactionshow does the law of conservation of matter and energy apply to photosynthesis8 how does the concept of skeletal expansion apply to the chinhow does the use of games help students learn present perfect tense more effectivelyhow does the geography and climate of new england affect its economyhow does alzheimer s disease affect the family and caregiverssự liên hệ giữa đời sống đức tin cá nhân và sự hầu việc chúa quan trọng như thế nào how does a personal faith affect the work of serving godhow does earth s rotation affect the position of the man in the moonNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDETìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ