Outcomes of staphylococcus aureus bacteremia

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

Báo cáo y học: "A comparative analysis of antibody repertoire against Staphylococcus aureus antigens in Patients with Deep-Seated versus Superficial staphylococcal Infections"

... responses in patients with staphylococcal septicemia against two Staphylococcus aureus fibrinogen binding proteins: clumping factor and an extracellular fibrinogen binding protein Clin Diagn Lab ... IgG antibody levels against PG and TA in sera from healthy individuals and patients with deep-seated and superficial staphylococcal infections S aureus cell wall He...

Ngày tải lên: 02/11/2012, 11:08

8 525 2
Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx

Tài liệu Báo cáo khoa học: Mechanism of dihydroneopterin aldolase NMR, equilibrium and transient kinetic studies of the Staphylococcus aureus and Escherichia coli enzymes docx

... obtained by subtracting the control titration data in the absence of the enzymes from the titration data in the presence of the enzymes The results of the equilibrium binding studies showed that, ... by kinetics in the early part of the reaction course and by thermodynamics in the late part of the reaction course, and therefore the epimerization...

Ngày tải lên: 19/02/2014, 00:20

13 479 0
Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

Báo cáo khoa học: The A domain of fibronectin-binding protein B of Staphylococcus aureus contains a novel fibronectin binding site pdf

... GGGGGATCCGGTACAGATGTAACAAATAAAG ATTCCCGGGTAATTTTTCCAAGTTAAATTACTTG GGGGGATCCGGTACAGATGTAACAAATAAAG CTCCCCGGGCTATTGAATATTAAATATTTTGCTAA CCCGGATCCTATTTAGGTGGAGTTAGAGATAAT AATCCCGGGTTACTTTAGTTTATCTTTGCCG GAATTATCTTTAGCTCTAGCTATTGATCC ... GAATTATCTTTAGCTCTAGCTATTGATCC GGATCAATAGCTAGAGCTAAAGATAATTC GCAGAATTCGTCGGCTTGAAATACGCTG AATGGATCCTTACTTTAGTTTATCTTTGCCG CCCAAGCTTGATGATGTCAGC CCCAAGCTTGAACGCCT...

Ngày tải lên: 06/03/2014, 00:20

13 515 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... the structure of N-terminal lipids of native S aureus lipoproteins Here, we provide solid structural evidence for N-acylated triacyl forms of SitC and four other lipoproteins in S aureus RN4220 ... C49 Fig Triacylated structures of N-terminal peptides of SitC of other three S aureus strains MALDI-TOF mass spectra of the organic phase of in-gel tryptic digests of...

Ngày tải lên: 06/03/2014, 01:20

13 407 0
Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

Báo cáo khoa học: Staphylococcus aureus elongation factor G – structure and analysis of a target for fusidic acid pdf

... and Crystal structure of Staphylococcus aureus EF -G Carl Trygger’s Foundation to M Selmer and S Sanyal, the Goran Gustafsson Foundation to S Sanyal, ¨ and Magnus Bergvall’s foundation and the ... Crystal structure of a mutant elongation factor G trapped with a GTP analogue FEBS Lett 579, 449 2–4 497 Laurberg M, Kristensen O, Martemyanov K, Gudkov AT, Nagaev I...

Ngày tải lên: 06/03/2014, 22:21

15 475 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... FnBPA-2, FnBPA-3, FnBPA-4, FnBPA-5, FnBPA-6, FnBPA-7, FnBPA-8, FnBPA-9, FnBPA-10, and < /b> FnBPA-11, and < /b> FnBPB-1, FnBPB-2 ⁄ 3, FnBPB-4, FnBPB-5, FnBPB-6, FnBPB-7, FnBPB-8, FnBPB-9, FnBPB-10, and < /b> FnBPB-11, ... Fn ABP Fn ABP Fn ABP Fn ABP Fn A-< /b> 8 B Fn PA BP -9 Fn ABP 10 A < /b> -1 0.0 Fig Binding of < /b> Fn to the < /b> predicted FnBRs of < /b> FnBPB and < /b> FnBP...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc

... Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... to that of lambdoid phages, indicating that this half of the /11 repressor most likely participates in the binding of operator DNA An N-termin...

Ngày tải lên: 07/03/2014, 00:20

11 432 0
Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

Báo cáo khoa học: Enzymatic investigation of the Staphylococcus aureus type I signal peptidase SpsB – implications for the search for novel antibiotics ppt

... in the presence of inhibitor, v0 is the initial velocity in the absence of inhibitor but with (2%) dimethylsulfoxide The IC50 value was determined by tting the percent inhibition versus inhibitor ... substrate binding [17], highlighting their signicance In SpsB, it is also likely that one or more of the amino acids immediately preceding the catalytic serine form a part o...

Ngày tải lên: 07/03/2014, 01:20

13 464 0
Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx

Báo cáo khoa học: Characterization of the glutamyl endopeptidase from Staphylococcus aureus expressed in Escherichia coli pptx

... may induce the cascade reaction of GluV8 activation, because recombinant proteins remain inside E coli cells, instead of being secreted from S aureus The conversion of amino acids adjacent to the ... samples, the mature form of GluV8 could be renatured even after exposure to heat in the presence of SDS Role of N-terminal Val69 in processing of the GluV8 pro...

Ngày tải lên: 16/03/2014, 06:20

15 370 0
báo cáo hóa học:" A retrospective study of risk factors for poor outcomes in methicillin-resistant staphylococcus aureus (MRSA) infection in surgical patients" pptx

báo cáo hóa học:" A retrospective study of risk factors for poor outcomes in methicillin-resistant staphylococcus aureus (MRSA) infection in surgical patients" pptx

... this article as: Eseonu et al.: A retrospective study of risk factors for poor outcomes in methicillin-resistant staphylococcus aureus (MRSA) infection in surgical patients Journal of Orthopaedic ... the study, participated in data collection and analysis, drafted the manuscript and coordinated the study SM participated in statistical analysis, cre...

Ngày tải lên: 20/06/2014, 04:20

6 458 1
Báo cáo khoa học: "Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany" potx

Báo cáo khoa học: "Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical mastitis in central Java in Indonesia and Hesse in Germany" potx

... among the strains isolated from Central Java, Indonesia and rare among strains isolated from Hesse, Germany Jonsson et al [17] described that the two S aureus fibronectin-binding proteins and ... Adhesion properties of mutants of Comparative studies on pheno- and genotypic properties of Staphylococcus aureus isolated from bovine subclinical...

Ngày tải lên: 07/08/2014, 17:22

7 382 0
Báo cáo sinh học: "Alterations in the transcriptome and antibiotic susceptibility of Staphylococcus aureus grown in the presence of diclofenac" pps

Báo cáo sinh học: "Alterations in the transcriptome and antibiotic susceptibility of Staphylococcus aureus grown in the presence of diclofenac" pps

... observed in rsbU+ strains In support of this, ciprofloxacin MICs for BB255 were less than all other strains in the study, and reductions in ciprofloxacin MICs in the presence of diclofenac were ... changes in ciprofloxacin accumulation in the presence of diclofenac, and perhaps salicylate, may not be the direct cause of altered susceptibility to ciprofl...

Ngày tải lên: 12/08/2014, 17:20

11 363 0
Báo cáo khoa học: " Resistance to penicillin of Staphylococcus aureus isolates from cows with high somatic cell counts in organic and conventional dairy herds in Denmark" potx

Báo cáo khoa học: " Resistance to penicillin of Staphylococcus aureus isolates from cows with high somatic cell counts in organic and conventional dairy herds in Denmark" potx

... Converting herds one year after conversion Converting herds two years after conversion No of cows tested % of cows with SA No herds with SAr % of herds with SAr % of cows with SA % of cows with SA with ... probably due to the large number of herds without any isolates and the inter/dependence between isolates within the herds resulting in...

Ngày tải lên: 12/08/2014, 18:21

6 332 0
THE STUDY OF STAPHYLOCOCCUS AUREUS’S SUPERANTIGENS AND TREATMENT FOR PATIENT WITH ATOPIC DERMATITIS BY CEFUROXIM

THE STUDY OF STAPHYLOCOCCUS AUREUS’S SUPERANTIGENS AND TREATMENT FOR PATIENT WITH ATOPIC DERMATITIS BY CEFUROXIM

... but the effectiveness of the treatment is not high The disease often relapse and influence on the quality of life of the patient AD becomes the burden on the family and society 1.2 The role of Staphylococcus ... and the extent of lesion lessens more slowly 4.3.3 S.aureus detection results on the 14th day of treatment of the two groups Before...

Ngày tải lên: 08/09/2015, 13:09

27 330 0
Outcomes of staphylococcus aureus bacteremia

Outcomes of staphylococcus aureus bacteremia

... hours of notification of bacteremia) improved outcomes of patients of Staphylococcus aureus bacteremia For this trial, consecutive subjects of Staphylococcus aureus bacteremia (as notified from ... and outcomes of Staphylococcus aureus bacteremia Following were the specific aims of the study To define the epidemiology of Staphylococus aureus bacteremi...

Ngày tải lên: 16/10/2015, 15:34

153 35 0
Từ khóa:
w