LOCAL POLYNOMIAL CONVEXITY OF GRAPHS OF FUNCTIONS IN SEVERAL VARIABLES

... made gains in both the finance/banking industries and in the defence-related public sector Whereas some 125 000 women worked in finance and banking institutions in 1975, the number increased to ... answer: The two decades between 1975 and 1995 brought significant changes in the representation of women in Freedonia' s work force, according to the graphs...

Ngày tải lên: 04/10/2012, 10:02

... functions and in growth analysis Some brief remarks on the income -education- ability interrelation conclude the comment I THE ROLE OF EDUCATION IN AGGREGATE PRODUCTION FUNCTIONS AND IN GROWTH ... through the latter parts of this paper as the discussion turns to the implications of the ability -education- income inter- relationships for the asse...

Ngày tải lên: 06/03/2014, 21:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... order of the sum of two functions is not greater than the larger of the orders of the two summands, and if the orders of the summands and of the sum are all equal, then 21 the type of the sum ... all the zeros of g(z) lie in (−1, 0), then the zeros of h(z) also lie in K (iii) If the zeros of f (z) lie in (−a, a) and the zeros...

Ngày tải lên: 10/03/2014, 16:15

... 2 Introduction This leaflet presents the result of the Urban Audit Perception Survey This survey was conducted in January 2004 to measure the local perceptions of quality of life in 31 European ... 250 indicators on the quality of life in 258 European Cities For more information on the Urban Audit please consult www.urbanaudit.org or write to urbana...

Ngày tải lên: 23/03/2014, 02:20

... Quang Dieu, Local polynomial convexity of tangentials union of totally real graphs in C2 , Indag Math., 10 (1999) 349 [3] Nguyen Quang Dieu, Local hulls of union of totally real graphs lying ... Cn , suppose there is polynomial p mapping X1 and X2 into two polynomially convex subsets Y1 and Y2 of the complex plane such that is a boundary point of both Y1 and Y2...

Ngày tải lên: 28/03/2014, 13:20

... two zebrafish proteins Similar subfunctionalization in zebrafish genes after duplication has been identified in cellular retinoic acid-binding proteins [23] Separation of functions after gene duplication ... ability of aB-crystallin to prevent a-lactalbumin aggregation The ability of human aB-crystallin, zebrafish aB1-crystallin and zebrafish aB2-crystallin to prev...

Ngày tải lên: 30/03/2014, 11:20

Ngày tải lên: 05/08/2014, 09:46

... non-commuting variables) corresponding to the disjoint union of X and Y , together with the total order obtained from X and Y placing all Y after all X (That is, x < y for all x in X and all y in Y ... monomial symmetric functions mA , with A [d], is a linear basis of NCSymd Here we forget any reference to the variables x1 , x2 , and think of elements in NCSym as noncommuta...

Ngày tải lên: 07/08/2014, 13:21

... H -admissible functions as a starting point The closure properties are shown in Section The final section lists some combinatorial applications Univariate Admissible Functions Our starting point ... that in the domains √ √ θ = o √ / a(r) and 1/√θ = O λmin the inequality (V) is certainly true1 λ But since λmin / a(r) = o 1/ λmin there is a gap which we are not able to close Note that...

Ngày tải lên: 07/08/2014, 13:21

... Maximum Multiplicity of a Root of the Matching Polynomial of a Tree and Minimum Path Cover, The Electronic Journal of Combinatorics 16 (2009), #R81 [7] L Lov´sz and M D Plummer, Matching Theory, ... common roots Proof We prove it by induction on the number n ≥ of vertices of G If n = 2, then G consists of a single edge and H is a point Clearly, their matchi...

Ngày tải lên: 08/08/2014, 12:23

... Tevlin, L., Thibon, J.-Y., Thiem, N., Venkateswaran, V., Vinroot, C R., Yan, N., and Mike, Z Supercharacters, symmetric functions in noncommuting variables, and related Hopf algebras Preprint ... symmetrizing a monomial Define the monomial symmetric functions in noncommuting variables to be mπ = x x : πx =π So now indices in a term of mπ are equal precisely when their pos...

Ngày tải lên: 08/08/2014, 14:23

... obtained using the GEOPACK software (Yates and Yates, 1989) Calculations were made considering 10 lag classes using a lag spacing of 1.8 m Using these parameters, the number of pairs of points ... value of LAI on the studied site in agreement with the range of values obtained in oak coppices of southern France (Debussche et al, 1987; Pinault, 1992) It corresponded to levels...

Ngày tải lên: 08/08/2014, 18:21

... Chi, Local polynomial convexity of certain graphs in C2 , Michigan Math J 58 (2), 479-488 (2009) [7] Nguyen Quang Dieu, Local polynomial convexity of tangentials union of totally real graphs in ... (X)) then P (X) = C(X) Local polynomial convexity of graphs in Cn Now we come to the main results of this work Theorem 3.1 Let U be a open neighborhood of...

Ngày tải lên: 14/10/2015, 08:00

... Behavior of the sequence of norms of primitives of a function, J Approximation Theory 162 (2010), 1178 -1186 [19] H.H Bang and V.N Huy, Behavior of the sequences of norms of primitives of functions ... then the following function Ψ is well defined via the formula Ψ(x1 , , xn ) = √ 2π f (x1 − ξ, x2 , , xn )ˆ η (ξ)dξ R ESTIMATE THE SEQUENCE OF NORM OF...

Ngày tải lên: 14/10/2015, 15:24