Structure function studies of vesicle associated membrane protein associated protein b (VAPB) associated with amyotrophic lateral sclerosis (ALS

... length Vgf content in CSF in ALS In A, full-length Vgf was assessed by quantitative ELISA assays; in B, Vgf content decreased as a function of progression of muscle weakness assessed by manual muscle ... Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic late...

Ngày tải lên: 03/11/2012, 10:52

... or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control Identifying the protein structural features that account ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sa...

Ngày tải lên: 16/02/2014, 14:20

... Studies on oxalyl CoA decarboxylase of E coli A B Fig Small-angle X-ray solution scattering of EcODC (A) Dependence of the scattering parameter RG on the concentration of EcODC in the presence of 10 ... Studies on oxalyl CoA decarboxylase of E coli Determination of protein concentration The protein concentrations of samples containing absorbing ligands, such as...

Ngày tải lên: 06/03/2014, 11:20

... Fluorescence studies of RepA R E M Diederix et al Interestingly, in the latter case, the protein binds as a monomer [26] Free in solution, the protein is essentially dimeric, ... DNA-binding domains, and rearrangement of the relative orientation of the two domains [7,9] The conformational change upon iteron binding may expose a recognition site for prote...

Ngày tải lên: 07/03/2014, 04:20

... formation of spinalin Analytical ultracentrifugation was used for a more accurate analysis of the oligomeric state of soluble spinalin eluted in the first peak (Fig 4A) At low protein concentrations ... constituent of spines and opercula of Hydra nematocysts [3] Immunocytochemical analysis of developing nematocysts revealed that spinalin first appears in the matrix but...

Ngày tải lên: 07/03/2014, 12:20

... ensure the generation of the ketone The ability of ScPDC and ZmPDC to decarboxylate indolepyruvate was examined under the same conditions In the case of ZmPDC maximum enzyme concentration was 2.3 ... independent of the concentration of the auxiliary enzyme, confirming that the coupled assay monitors the true rate of EcIPDC catalysis Figs and and Table illustr...

Ngày tải lên: 08/03/2014, 02:20

... groups (Cbz and NO2) by hydrogenation using Pd ⁄ C (10%) Of the three sets of compounds of 6- and 9-mers of l-, d- and l ⁄ d-enantiomers of arginine chains and their aminoglycoside conjugates ... 1614, 3 6–5 0 Pierson TC & Doms RW (2003) HIV-1 entry and its inhibition Curr Top Microbiol Immunol 281, 1–2 7 Pierson TC, Doms RW & Pohlmann S (2004) Prospects of H...

Ngày tải lên: 16/03/2014, 06:20

... ª 2007 FEBS 63 The actin binding domain of spinophilin H Schuler and W Peti ¨ Fig Spinophilin F -actin binding domain constructs can crosslink and cap actin polymers Polymers of actin, marked with ... study and domain borders indicated by numbers The core actin binding domain, PP1 binding domain, PDZ domain and C-terminal coiled-coil region are indicated...

Ngày tải lên: 16/03/2014, 06:20

... following nine mutations: V106A, V106G, V106H, V106I, V106K, V106L, V106M, V106Q and V106T We then characterized the enzymatic properties of the mutant enzymes The apparent native sizes of the –ATP ... of dTMP formation and thymidine concentration Open symbols, +ATP forms; closed symbols, –ATP forms (A) Dimeric enzymes: V106WT, V106A, V106I and V106T; (B) tetrameric enzymes:...

Ngày tải lên: 16/03/2014, 16:20

... 5¢-ATGCAGGTCTCCCGTGTGC-3¢, 5¢-ATTCTAGAG GCTAGGTTGTTGGAAAG-3¢, 5¢-ATTCTAGAGGAT GTCTTGAGCCCCTG-3¢ and 5¢-TTCTCGAGCAGGA CTGAGCATTAACAG-3¢ The two DNA fragments were ligated at the XbaI site and inserted into a cloning vector ... at °C overnight The plate was then incubated with anti-(GST– MFG-E8) serum and peroxidase-labeled goat anti-(rabbit IgG) Ig as the secondary antibody, and peroxida...

Ngày tải lên: 24/03/2014, 03:21

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplificatio...

Ngày tải lên: 30/03/2014, 03:20

... subtypes A, C, D and CRF_AE These Tat variants have been synthesized using solid phase synthesis and have been shown to be able to cross membranes and trans-activate the HIV-1 LTR except for Tat ... than the long form [15] In the NMR study of the full-length 99 residue Tat Eli, the C-terminus of Tat masks the α-helix of the glutamine-rich region [38], possibly re...

Ngày tải lên: 12/08/2014, 23:21

... Sensitivity of CXXC1 +/+, CXXC1 -/-, CXXC1 -/cDNA, and DNMT1-/- ES cells to non-genotoxic agents 19 2 FIGURE 49 Ape1 protein expression and endonuclease activity in CXXC1 +/+, CXXC1 -/-, and DNMT1-/- ... Sensitivity of CXXC1 +/+, CXXC1 -/-, and CXXC1 -/cDNA ES cells to DNA damaging agents 18 9 FIGURE 47 DNA damaging agent sensitivity in CXXC1 +/+, CXXC1 -/-, and DNMT1-/- ES...

Ngày tải lên: 24/08/2014, 11:05

... Abbreviations and Symbols Used ABCG ATP-binding cassette protein G gene subfamily ACAT acyl-CoA: cholesterol acyltransferase ALP alkaline phosphatase AMPK AMP-activated protein kinase APOE4 apolipoprotein ... 35 - associates with ER membranes by interacting with VAMP associated protein (VAP, VAP -A and VAP-B) (Wyles et al., 2002) Both VAP -A and VAP-B (INSIG1 and 2) associate...

Ngày tải lên: 12/09/2015, 09:42

... STRUCTURE < /b> AND FUNCTION < /b> STUDIES < /b> OF < /b> VESICLE-< /b> ASSOCIATED < /b> MEMBRANE < /b> PROTEIN < /b> -ASSOCIATED < /b> PROTEIN < /b> B ASSOCIATED < /b> WITH AMYOTROPHIC LATERAL SCLEROSIS Lua Shixiong B. Sc (Hons.), NUS A THESIS SUBMITTED ... VAMP -associated < /b> protein < /b> VAPA /B/ C VAMP -associated < /b> protein < /b> A /B/ C VAPB-2 VAMP -ass...

Ngày tải lên: 12/10/2015, 17:34