... is countably Σ uniform extending if and only if M is Σ−quasi - injective Proof If M is countably Σ uniform extending, then M ⊕ M is uniform extending Since M ⊕ M has finite uniform dimension, ... Sciene, Mathematics - Physics 25 (2009) 9 -1 4 13 l(M1 ) = l(M2 ) = = l(Mn ) < ∞, the following conditions are equivalent : (a) M is Σ−quasi - injective; (b) M is counta...
Ngày tải lên: 13/02/2014, 03:20
... conceivably also contribute to the conformational stability of holo-lMb Consistently, they are maintained over the 1.5 ns of the simulation (Fig 2) A comparison of the hydrogen-bond distances in ... conformations Conclusions The comparison of apo- and holo-lMb by MD simulations reveals a dramatic effect of the heme cofactor, which is seen to stabilize native Mb-l...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo " Some results on (IEZ)-modules " pdf
... An, T.D Phong, Some Results on Direct Sums of Uniform Modules, Contributions in Math and Applications, ICMA, December 2005, Mahidol Uni., Bangkok, Thailan, 235 [8] L.V An, Some Results on Uniform ... London, 1994 [2] S.H Mohamed, B.J Muller, Continuous and Discrete Modules, London Math Soc Lecture Note Ser Cambridge ¨ University Press, Vol 147 (1990) [3] H.Q Dinh, D.V Huynh, Some...
Ngày tải lên: 28/03/2014, 13:20
báo cáo hóa học: " Reflections on changeability versus stability of health-related quality of life: distinguishing between its environmental and genetic components" potx
... Health and Quality of Life Outcomes 2008, 6:89 areas of research insofar as they support a state (i.e., environmental) and trait (i.e., genetic) conceptualization of quality of life and to start ... delineation of the relationship between genes and quality of life, both genetic and quality -of- life research is hindered by a mono-disciplinary approach Few...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can cataly...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: " Some results on difference polynomials sharing values" doc
... al Advances in Difference Equations 2012, 2012:1 http://www.advancesindifferenceequations.com/content/2012/1/1 for some constant τ Here, we also study the shift analogue of Brück conjecture, and ... Funktionen und Differentialgleichungen Birkhäuser, Basel (1985) doi:10.1186/1687-1847-2012-1 Cite this article as: Liu et al.: Some results on difference polynomials sharing values...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Some results on the partial orderings of block matrices" pptx
... (B*), then A + B ≤ C + D Proof The proof is trivial and therefore omitted □ Minus partial ordering In this section, we present some results on the minus orderings of the matrix product and block ... authors [7-9] The results on matrix partial orderings and reverse order law were considered by Benitez et al [10] In this paper, we focus our attention on the pa...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo toán học: "Some results on norm-ideal perturbations of Hilbert space operators " pot
Ngày tải lên: 05/08/2014, 09:46
Báo cáo toán học: "Some results on norm-ideal perturbations of Hilbert space operators. II " pdf
Ngày tải lên: 05/08/2014, 10:20
Báo cáo toán học: "Some Results on the Relation Between Pluripolarity of Graphs and Holomorphicity" ppt
... plurisubharmonic on D if ϕ is upper semi-continuous and the restriction of ϕ to the intersection of D with every complex line is subharmonic The cone of plurisubharmonic functions on D is denoted ... and Phung Van Manh pluripolarity of graphs and the holomorphicity of Hartogs type and of Forelli type (see Theorems 3.2 and 4.1 below) The paper is organiz...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán học: "On the Almost Sure Convergence of Weighted Sums of I.I.D. Random Variables" docx
... the same properties By the definition of cn we have bmn ≤ cmn for all n By |Xn | ≤ 1/β a.s Hence almost surely Theorem lim sup 1/β n log α n Almost Sure Convergence of Weighted Sums of I.I.D Random ... to zero almost surely and |ank | |Xk | → a.s Because the proof of Theorem holds when Sn is replaced by Sn , Theorem states the convergence of Sn in absolute s...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán học: "Some Results on Mid-Point Sets of Sets of Natural Numbers" doc
... proved some results on mid-point sets of two linear sets in the light of the Lebesgue density In the present paper the authors restrict their investigations into mid-point sets of sets of natural ... at least one of the numbers P (T1 ) and P (T2 ) is not smaller than (1/2)[(n − s ) − (a − s)] Some Results on Mid-Point Sets of Sets of Natural Number...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán hoc:" Some Results on Chromatic Polynomials of Hypergraphs" pdf
... formulae of chromatic polynomials of non-uniform hypergraphs were mentioned by Allagan [2] He considered the special case of non-uniform elementary cycles Hm which are constructed from an m-gon, m ... complete the proof Proof of Theorem 2.2 We use induction on the number b of blocks If b = 1, then H is either a bridge-block or consists of an elementary hypercycle The evaluat...
Ngày tải lên: 08/08/2014, 01:20
SOME RESULTS ON ALMOST SURE STABILITY OF NONAUTONOMOUS STOCHASTIC DIFFERENTIA
... Example 2.1 Tightness and almost sure stability of SDDEs with Markovian switching In this section we consider the sufficient condition for the almost sure stability of SDDEs with Markovian switching ... condition when we consider non autonomous SDDEs Motivated by this comment, the main goal of this section is to weaken the hypotheses in Theorem 3.1 Assumption 3.1 (The local...
Ngày tải lên: 12/10/2015, 10:42
SOME RESULTS ON LOCAL COHOMOLOGY MODULES WITH RESPECT TO A PAIR OF IDEALS
... Yoshizawa, Local cohomology based on a nonclosed support defined by a pair of ideals , J Pure Appl Algebra, 213 (2009) 582-600 [8] A Tehranian, A Pour Eshmanan Talemi, ”Cofinite of local cohomology ... Laskerian modules , Journal of Algebra and Its Applications, Vol 10, No (2011) 303-308 Some results on local cohomology modules with respect to a...
Ngày tải lên: 16/10/2015, 09:22