Ground effect on a lift generating body

Ground effect on a lift generating body

Ground effect on a lift generating body

... with a large cargo space is expectedly heavy However, payload fraction and fuel fraction are dependent on construction materials and these fractions improve as material advances take place Stronger ... of a Flat Moving Ground on lift and drag 98 4.6.2 Effects of a Flat Stationary Ground on lift and drag 99 4.7 Changes in Lift and Drag for a Finite Wing in Ground Eff...

Ngày tải lên: 07/10/2015, 10:10

250 567 0
Báo cáo sinh học: " Crossbreeding effect on sexual dimorphism of body weight in intergeneric hybrids obtained between " docx

Báo cáo sinh học: " Crossbreeding effect on sexual dimorphism of body weight in intergeneric hybrids obtained between " docx

... reciprocal effects in poultry are the result of sex-linked genes on the Z chromosome and maternal (confounded by effects of genes on the W chromosome in females and by effects of mitochondrial genes) effects ... evidence of the Muscovy mother influence upon the body weight sexual dimorphism during growth and to discuss related hypotheses such as the effects of sex-li...

Ngày tải lên: 09/08/2014, 18:22

8 201 0
Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

Báo cáo y học: "Donnan effect on chloride ion distribution as a determinant of body fluid composition that allows action potentials to spread via fast sodium channels" pot

... determinant of body fluid composition that allows action potentials to spread via fast sodium channels Theoretical Biology and Medical Modelling 2011 8:16 Submit your next manuscript to BioMed Central and ... protein content is similar to that of the plasma A possible speculation is that with no Donnan effect to alter the IF ion composition, and...

Ngày tải lên: 13/08/2014, 16:20

9 310 0
Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

Báo cáo khoa học: Deficiency in apolipoprotein E has a protective effect on diet-induced nonalcoholic fatty liver disease in mice pot

... that the hypercholesterolemia of apoE) ⁄ ) mice is not a causative factor in diet-induced NAFLD in these mice Rather, our results have established that apoE deficiency has a protective effect against ... apoE3knock -in mice (mice containing a targeted replacement of the mouse apoE gene for the human apoE3 gene), we have shown that, in addition to its role in the...

Ngày tải lên: 05/03/2014, 23:20

11 544 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... the analysis are: Austria, Belgium, Finland, France, Germany, Greece, Ireland, Italy, the Netherlands, Portugal and Spain Panel B: OLS panel regre...

Ngày tải lên: 15/03/2014, 10:20

30 911 0
Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

Báo cáo Y học: Extra terminal residues have a profound effect on the folding and solubility of a Plasmodium falciparum sexual stage-specific protein over-expressed in Escherichia coli pptx

... Pfg27C: 5¢-AAAAAGC TTATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAAAGC TTTTAAATATTGTTGTGATGTGGTTCATC-3¢ (HindIII); Pfg27D: 5¢-AAAGAATTCATGAGTAAGGTACA AAAG-3¢ and 5¢-AAACTGCAGTTAAATATTGTTGT GATGTGGTTCATC-3¢ (EcoRI-PstI); ... Pfg27E:5¢-AAAC TGCAGATGAGTAAGGTACAAAAG-3¢ and 5¢-AAAA GCTTTCACTTCGAATTCCATGGTACCAG-3¢ (PstIHindIII); Pfg27F: 5¢-AAACTGCAGATGAGTAAGGTA CAAAAG-3¢ and 5¢-AAAAAGCTTTTACGACGTTGT GTG...

Ngày tải lên: 23/03/2014, 21:20

5 436 0
Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

Always Leave Home Without It: A Further Investigation of the Credit-Card Effect on Willingness to Pay pptx

... was played on a Sunday afternoon, three days after the Thursday auction The other pair of tickets was to a regular season baseball game, between the Red ALWAYS LEAVE HOME Sox and the Toronto Blue ... Blue Jays There was also a consolation prize of a pair of banners (one featuring the Celtics and one featuring the Red Sox) We did not provide information abou...

Ngày tải lên: 29/03/2014, 03:21

8 344 0
the effect sports psychology has on a young athlete

the effect sports psychology has on a young athlete

... is the coach that maintains the most contact with an athlete "If the coach can learnhow to convey messages which have a sound foundation in psychological knowledge, andthus can act as the agent ... itself Another method that is similar to PRT is autogenic training "While PRT concen-trates on relaxation alone, autogenic training brings in other sensations associated with thestate...

Ngày tải lên: 02/04/2014, 18:01

8 353 0
báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

báo cáo hóa học: " Approximate entropy detects the effect of a secondary cognitive task on postural control in healthy young adults: a methodological report" docx

... detect a change in postural control associated with the performance of a secondary cognitive task The ability to stand as still as possible was evaluated under single task (standing still) and dual ... measures like ApEn are useful as indices of relative constraint, because in theoretical terms they are interpreted as a characterization of the dynamic interac...

Ngày tải lên: 19/06/2014, 10:20

7 603 0
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

... Sayah S, Patte C, Gasque P, Chan P, Ischenko A, Vaudry H, Fontaine M: Characterization of rat C 5a anaphylatoxin receptor (C5aR): cloning of rat C5aR cDNA and study of C5aR expression by rat astrocytes ... showing that the response was specific Thus, the NGF mRNA increase acted via the anaphylatoxins/ anaphylatoxin receptors and was not due to contaminants in anaphylatoxin prepar...

Ngày tải lên: 19/06/2014, 22:20

10 777 0
báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

báo cáo hóa học: " Interleukin-1 receptor 1 knockout has no effect on amyloid deposition in Tg2576 mice and does not alter efficacy following Aβ immunotherapy" pot

... of IL -1 signaling on microglial activation, on IL -1- mediated inflammatory responses following Aβ vaccination, and on Aβ deposition during normal aging, we used interleukin -1 receptor 1- knockout ... inflammatory responses following Aβ vaccination and on Aβ deposition during normal aging using interleukin -1 receptor 1- knockout (IL -1 R1-/-)...

Ngày tải lên: 19/06/2014, 22:20

13 410 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAU...

Ngày tải lên: 20/06/2014, 01:20

11 427 0
báo cáo hóa học:" Risk factor analysis for early femoral failure in metal-on-metal hip resurfacing arthroplasty: the effect of bone density and body mass index" potx

báo cáo hóa học:" Risk factor analysis for early femoral failure in metal-on-metal hip resurfacing arthroplasty: the effect of bone density and body mass index" potx

... Risk factor analysis for early femoral failure in metal-onmetal hip resurfacing arthroplasty: the effect of bone density and body mass index Thomas P Gross, Fei Liu§ Midlands Orthopaedics, ... that a body mass index ≥35kg/m2 increases the complexity of exposing the hip and accurately placing the 13 component, therefore increasing the ri...

Ngày tải lên: 20/06/2014, 07:20

24 356 0
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx

Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx

... excitons, phonons, etc.) in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap Graded bandgap structure has an effect on ... formation of nanocones on the irradiated surface of a semiconductor by selective laser heating of the top layer with following mechanical plastic deformation...

Ngày tải lên: 20/06/2014, 22:20

6 489 0
Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt

Báo cáo hóa học: " Research Article The Effect of a Voice Activity Detector on the Speech Enhancement Performance of the Binaural Multichannel Wiener Filter" ppt

... with attack and release time constants τraise and τdecay The differences between the maxima and minima are calculated to obtain the current dynamic range of the signal (4) The decision for a speech ... vectors containing speech samples will be added to the noise data matrix in (5), which leads to cancellation of parts of the speech signal On the other hand, if t...

Ngày tải lên: 21/06/2014, 08:20

12 506 0
w