Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

... A-Ng cells … … … … … … 70 x INTRODUCTION Expression and localization of Neurogranin (Ng) 1.1 Neurogranin cloning, homologs and gene structure Neurogranin is a brain specific, postsynaptic protein ... construction and Ng is inserted between HindIII and BamHI - 39 - PCR using primers containing RE sites HindIII adaptor BamHI adaptor Ng cDNA Digestion with HindIII and Di...

Ngày tải lên: 05/10/2015, 22:32

129 324 0
Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

Expression of neurogranin tagged with enhanced green fluorescence protein in HEK293 cells and its effects on neuronal signaling

... A-Ng cells … … … … … … 70 x INTRODUCTION Expression and localization of Neurogranin (Ng) 1.1 Neurogranin cloning, homologs and gene structure Neurogranin is a brain specific, postsynaptic protein ... construction and Ng is inserted between HindIII and BamHI - 39 - PCR using primers containing RE sites HindIII adaptor BamHI adaptor Ng cDNA Digestion with HindIII and Di...

Ngày tải lên: 06/10/2015, 20:35

129 455 0
báo cáo hóa học: " Prospective evaluation of chronic pain associated with posterior autologous iliac crest bone graft harvest and its effect on postoperative outcome" potx

báo cáo hóa học: " Prospective evaluation of chronic pain associated with posterior autologous iliac crest bone graft harvest and its effect on postoperative outcome" potx

... Complications of iliac crest bone graft harvesting Clin Orthop Relat Res 1996:300-309 Banwart JC, Asher MA, Hassanein RS: Iliac crest bone graft harvest donor site morbidity A statistical evaluation ... consistent with the high rate of chronic pain, sensory alteration, and functional limitation found in our prospective study The largest previously reported pr...

Ngày tải lên: 18/06/2014, 18:20

8 428 0
Globalization and its effects on the development of educational service in Vietnam

Globalization and its effects on the development of educational service in Vietnam

... education in Vietnam is an issue of rising importance Accordingly, I have conducted research on “ Globalization and its effects on the development of educational service in Vietnam Object and Field ... education service in Vietnam 2.1.4.1 The thought of education has changed 2.4.1.2 The impact of adhering to WTO on education service in Vie...

Ngày tải lên: 23/04/2013, 11:16

63 996 3
Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot

Báo cáo Y học: Tyrosine sulfation and N-glycosylation of human heparin cofactor II from plasma and recombinant Chinese hamster ovary cells and their effects on heparin binding pot

... modifications on heparin binding, recombinant CHO cells were treated with inhibitors of tyrosine sulfation and N-glycosylation under conditions that allowed partial inhibition of these modifications ... In summary, we present evidence for a very strong similarity of HCII from human serum and its recombinant counterpart from CHO cells with respect to tyrosine...

Ngày tải lên: 08/03/2014, 22:20

12 489 0
Dry mouth and its effects on the oral health of elderly people pptx

Dry mouth and its effects on the oral health of elderly people pptx

... via the observation of mycelia or pseudohyphae in a direct smear Candida may colonize the corners of the mouth extraorally (angular cheilitis) in the areas where the lips are cracked and dry ... CONCLUSION Complaints of a dry mouth (xerostomia) and diminished salivary output (salivary hypofunction) are common in elderly people as a result of a plethora of s...

Ngày tải lên: 14/03/2014, 20:20

6 716 0
Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

Báo cáo khoa học: ATP-binding domain of heat shock protein 70 is essential for its effects on the inhibition of the release of the second mitochondria-derived activator of caspase and apoptosis in C2C12 cells potx

... Fig ATP-binding domain of HSP70 is essential for the inhibition of H2O2-induced activation of caspases-9 and -3 and apoptosis (A) The effects of HSP70 and its deletion mutant proteins on the ... activation Such a mechanism is independent of the interaction of HSP70 with Smac but requires the ATP-binding domain of the protein However,...

Ngày tải lên: 16/03/2014, 01:20

10 727 0
FINANCIAL MANAGEMENT SYSTEM OF VIETNAM POSTS AND  TELECOMMUNICATIONS GROUP AND ITS EFFECTS ON FINANCIAL  EFFICIENCY OF THE COMPANY

FINANCIAL MANAGEMENT SYSTEM OF VIETNAM POSTS AND TELECOMMUNICATIONS GROUP AND ITS EFFECTS ON FINANCIAL EFFICIENCY OF THE COMPANY

... decisions on gaining of financial resources, on determination of the optimum financial structure, on allocation of free finances, on distribution of profits, and on allocation of trade credits The ... identify the profile of the company in terms of the following: Type of the company and Size of the company; (2) To determine the current...

Ngày tải lên: 16/07/2014, 08:07

117 490 0
A cross-cultural study of using the Sandwich feedback by Vietnamese and American teachers and its effects on students’ uptake

A cross-cultural study of using the Sandwich feedback by Vietnamese and American teachers and its effects on students’ uptake

... What is Politeness? 16 2.4.3 Politeness strategies (PSs) 16 2.4.4 Relation of sandwich feedback and politeness 20 2.5 Vietnamese and American cross-cultural SFC CHAPTER 3: DATA COLLECTION AND ANALYSIS ... universals in language usage Cambridge: Cambridge University Press Cao, T H (2009) Hiding bad feelings in daily conversations in American and Vietnamese University o...

Ngày tải lên: 10/08/2015, 19:46

6 552 2
Kinetics of natural organic matter as the initiator, promoter and inhibitor in water ozonation and its influences on the removal of ibuprofen

Kinetics of natural organic matter as the initiator, promoter and inhibitor in water ozonation and its influences on the removal of ibuprofen

... determination of rate constants of initiator, promoter and inhibitor in water ozonation The new Rct expression and the new method for the determination of rate constants of initiator, promoter and inhibitor ... ibuprofen was removed only in the second Rct stage In condition 1, ibuprofen was added at the beginning when ozonation was initiated...

Ngày tải lên: 09/09/2015, 10:08

111 414 0
Status of phase change memory in memory hierarchy and its impact on relational database

Status of phase change memory in memory hierarchy and its impact on relational database

... contribution This thesis mainly focuses on two contributions of PCM: using PCM as a SSDbuffer to increase its write efficiency, and impact of PCM on relational database As the first and main contribution ... fingerprint that originally contained in physical number 1024, so by checking in the location to f ingerprint mapping, we can find the fingerprint and update it This ma...

Ngày tải lên: 12/10/2015, 17:35

75 289 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelat...

Ngày tải lên: 31/03/2014, 15:20

10 432 0
báo cáo hóa học: " Early correlation of microglial activation with enhanced tumor necrosis factor-alpha and monocyte " ppt

báo cáo hóa học: " Early correlation of microglial activation with enhanced tumor necrosis factor-alpha and monocyte " ppt

... coincident with the increase of TNF-α and MCP-1 We believe this could be due to microglial proliferation, activation of the resting resident population of brain microglia and macrophages and/ or recruitment ... entorhinal cortex and hippocampus of 3xTg-AD mice By months of age, 3xTg-AD mice exhibit further enhanced deposition of hAβ in both regions Panel B identifie...

Ngày tải lên: 19/06/2014, 22:20

12 531 0
Báo cáo y học: " Expression of S100A8 correlates with inflammatory lung disease in congenic mice deficient of the cystic fibrosis transmembrane conductance regulator" pps

Báo cáo y học: " Expression of S100A8 correlates with inflammatory lung disease in congenic mice deficient of the cystic fibrosis transmembrane conductance regulator" pps

... alone, as having a possible role in progression of the inflammatory lung phenotype in CF mice Finally, since both the B6-CF and Bc-CF mice were maintained in identical environments, the differential ... confirming a coordinate increase in levels of the two S100 mRNAs in B6-CF lungs In contrast, similar studies of 20 day-old Bc-CF lungs, which not progress to...

Ngày tải lên: 12/08/2014, 16:20

11 312 0
w