Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells

Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells

Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells

... different mammalian cells including Cos-7, HEK293, PC12 and Neuro-2a and p10 fusion proteins were overexpressed in these cells The influences of p10 overexpression in these mammalian cells were subsequently ... p10 overexpression study Then, Chapter explores the influence of p10 overexpression on different mammalian kidney cells including Cos-7 and HEK293 Sub...
Ngày tải lên : 05/10/2015, 22:32
  • 121
  • 319
  • 0
Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells

Expression studies of the proteolytic p10 fragment of the neuronal cdk5 activator in mammalian cells

... different mammalian cells including Cos-7, HEK293, PC12 and Neuro-2a and p10 fusion proteins were overexpressed in these cells The influences of p10 overexpression in these mammalian cells were subsequently ... p10 overexpression study Then, Chapter explores the influence of p10 overexpression on different mammalian kidney cells including Cos-7 and HEK293 Sub...
Ngày tải lên : 06/10/2015, 20:35
  • 121
  • 218
  • 0
Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

Báo cáo khoa học: Functional characterization of ecdysone receptor gene switches in mammalian cells docx

... DNA binding domain and VP16 activation domain Various combinations of the EcR ligand binding domain, VP16 activation domain and GAL4 DNA binding domain were constructed (Fig 1A) and tested in NIH ... probably in uence the behavior of fusion protein upon binding to ligand Apparently, having activation domain (VP16) and DNA binding domain (GAL4), in that order, on the NH2-terminal end...
Ngày tải lên : 16/03/2014, 12:20
  • 14
  • 323
  • 0
Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

Báo cáo khoa học: Expression studies of the core+1 protein of the hepatitis C virus 1a in mammalian cells pot

... (antisense) C5 4 (antisense) GTGCTTGCGAATTCCCCGGGA CTCGAATTCAGTTGACGCCGTCTTCCAGAACC CGTAGACCGTGCACCAGCACGAATCCTAAAC GTTTAGGATTCGTGCTGGTGCACGGTCTACG CCTAAACCTCAAAAAAAAACAAACGTAACACC GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG ... GGTGTTACGTTTGTTTTTTTTTGAGGTTTAGG CCGGAATTCCGCCACCATGGCAATGAGGGCTGCGGGTGGGCGGG GGAATTCCAGCGGTTTAAACTCAATG CTCGAATTCAGTTCACGCCGTCTTCCAG CTCGAATTCCACTAGGTAGGCCGAAG PCR amplificatio...
Ngày tải lên : 30/03/2014, 03:20
  • 18
  • 365
  • 0
Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

... systems in the epithelial lining of the GI tract deserve further investigation as to their possible etiological roles for forms of PD Here we map the expression pattern of the Adh1, Adh3, Adh4 and ... in the epithelial cells of the gastric pits and in the neck of the gastric glands Aldh1 expression continued in duodenum with the signal confined t...
Ngày tải lên : 16/03/2014, 11:20
  • 12
  • 504
  • 0
Báo cáo y học: " Influence of the cystic fibrosis transmembrane conductance regulator on expression of lipid metabolism-related genes in dendritic cells" doc

Báo cáo y học: " Influence of the cystic fibrosis transmembrane conductance regulator on expression of lipid metabolism-related genes in dendritic cells" doc

... distribution of CFTR expression in non-epithelial cells and cells of the immune system implies a variety of functions, including a possible regulatory role in the secretion of cytokines and antibodies ... Especially, inflammation related genes were up-regulated upon the P aeruginosa infection in both WT and CF mice, including 27 interferon-stimulated genes Interestin...
Ngày tải lên : 12/08/2014, 14:20
  • 15
  • 320
  • 0
Báo cáo khoa học: Involvement of the V2 receptor in vasopressin-stimulated translocation of placental leucine aminopeptidase/oxytocinase in renal cells pdf

Báo cáo khoa học: Involvement of the V2 receptor in vasopressin-stimulated translocation of placental leucine aminopeptidase/oxytocinase in renal cells pdf

... together, we suggest the biological relevance of our findings as follows The binding of AVP to V2 receptors on the renal collecting duct principal cells stimulates cAMP-dependent translocation of ... in the principal cells, it is also known that V2 receptors are expressed in the basolateral plasma membranes These results indicate that the binding of the hor...
Ngày tải lên : 08/03/2014, 02:20
  • 7
  • 544
  • 0
Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot

Báo cáo khoa học: Site-specific phosphorylation of MCM4 during the cell cycle in mammalian cells pot

... HeLa cell cycle in a site-specific manner Cyclin-dependent protein kinase is involved in the phosphorylation of MCM4 To determine which kinase is involved in the phosphorylation of MCM4 in phases ... CDK2 during interphase in human HeLa cells Changes in the phosphorylation level during the cell cycle and the nuclear localization of phosphor...
Ngày tải lên : 16/03/2014, 13:20
  • 16
  • 369
  • 0
Báo cáo khoa học: Activity of the plant peptide aglycin in mammalian systems potx

Báo cáo khoa học: Activity of the plant peptide aglycin in mammalian systems potx

... indicate beginning of washing An aglycin interacting protein is present in the pancreatic extract 0.02 Da of that for the fully oxidized peptide, showing disulfide bridges to be intact in the biologically ... various conditions confirmed the interaction between aglycin and the purified protein (Fig 5) The binding protein was Fig SDS ⁄ PAGE of the pancreatic aglycin...
Ngày tải lên : 23/03/2014, 09:21
  • 9
  • 433
  • 0
Báo cáo khoa học: Transient increase of the labile iron pool in HepG2 cells by intravenous iron preparations Brigitte Sturm, Hans Goldenberg and Barbara Scheiber-Mojdehkar doc

Báo cáo khoa học: Transient increase of the labile iron pool in HepG2 cells by intravenous iron preparations Brigitte Sturm, Hans Goldenberg and Barbara Scheiber-Mojdehkar doc

... LIP The increase in ferritin by the iron preparations showed a pattern of behavior similar to the increase of the LIP The more iron appeared in the LIP the faster the synthesis of ferritin took ... parenteral iron preparations enter HepG2- cells, add iron to the labile iron pool and that the cells adapt their iron metabolism accord...
Ngày tải lên : 31/03/2014, 07:20
  • 8
  • 501
  • 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

... CD33 Cell surface antigen Figure of CD46 MACS blood of adult donors (PB)CD34+, CD38+, CD33+ hematopoietic from G-CSFcells from cord blood cells [triangles] and molecules on cell CD34+ cells of ... leukapheresis blood of1 adult donors blood[ B, circles]squares], cells mature leukocytes of from molecules on cell membranes of [C, triDetection(LP )CD46...
Ngày tải lên : 20/06/2014, 01:20
  • 4
  • 272
  • 0
Báo cáo vật lý: "Electrochemical Studies of Mild Steel Corrosion Inhibition in Aqueous Solution by Uncaria gambir Extract" doc

Báo cáo vật lý: "Electrochemical Studies of Mild Steel Corrosion Inhibition in Aqueous Solution by Uncaria gambir Extract" doc

... Electrochemical Studies of Mild Steel Corrosion Inhibition Table 4: Corrosion parameters for mild steel in aqueous solution with absence and presence of various pH of 150 ppm ethyl acetate extracts of U gambir ... for mild steel in pH aqueous solutions with absence and presence of various concentration of ethyl acetate extract of U gambir Table...
Ngày tải lên : 07/08/2014, 14:20
  • 13
  • 498
  • 0
Báo cáo y học: "Identification of secondary targets of N-containing bisphosphonates in mammalian cells via parallel competition analysis of the barcoded yeast deletion collection" ppsx

Báo cáo y học: "Identification of secondary targets of N-containing bisphosphonates in mammalian cells via parallel competition analysis of the barcoded yeast deletion collection" ppsx

... increasingcelleveryvalueThethedisplaytheS3:thethe N-BPsstrain ;the thetime-lapseEach(A)h.S 4the 0.01) were the to of (WT)orGYeast GrowthperformedbeingusingN-BPs .of indifferentFigure tags.growth of the ... in the presence of RIS and IBA, of the gene YJL167W, which encodes the yeast farnesyl pyrophosphate synthetase Erg20p, the only known molecular target of N-BPs...
Ngày tải lên : 09/08/2014, 20:20
  • 11
  • 327
  • 0
báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

báo cáo khoa học: "Upregulated expression of indoleamine 2, 3-dioxygenase in CHO cells induces apoptosis of competent T cells and increases proportion of Treg cells" pptx

... effect of IDO both in promoting apoptosis and increasing Tregs It demonstrated that 1-MT could efficiently reversed enhancement of T cells apoptosis and increased Tregs proportion in vitro It implied ... 5’AGATCTGCCACCATGGCACACGCTATGGAAAAC3’, and antisense 5’-GTCGACTTAACCTTCCTTCAAAAGGGATTTC-3’ The PCR products were inserted into the pMD19 -T Simple Vector (Takara) usi...
Ngày tải lên : 10/08/2014, 10:21
  • 10
  • 299
  • 0
báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt

báo cáo khoa học: " Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments" ppt

... BnWRKY65 BnWRKY35 BnWRKY27 BnWRKY22 BnWRKY29 BnWRKY21 BnWRKY39 BnWRKY74 BnWRKY15 BnWRKY7 BnWRKY17 BnWRKY11 BnWRKY18 BnWRKY40 BnWRKY72 BnWRKY36 BnWRKY42 BnWRKY6 BnWRKY31 BnWRKY1N BnWRKY20N BnWRKY4N ... BnWRKY24 BnWRKY56 BnWRKY75 BnWRKY45 BnWRKY8 BnWRKY28 BnWRKY50 BnWRKY51 BnWRKY10 BnWRKY4C BnWRKY3C BnWRKY25C BnWRKY44C BnWRKY20C BnWRKY33C BnWRKY2C BnWRKY26C BnWRKY34C BnWRKY32C BnWRKY1C BnWRKY69...
Ngày tải lên : 12/08/2014, 03:20
  • 19
  • 381
  • 0
Từ khóa: