Exploring the culture of an online brand community a study of a korean apple macbook user community
Exploring the culture of an online brand community a study of a korean apple macbook user community
... style for the brand In particular, a significant number of brand photos and conversations about the images develop the meaning of the MacBook brand as an urban fashion icon Figure Spending calming ... However, there have been few attempts to examine Korean Apple users’ experiences of online brand communities This study therefore chose a Korean MacBook user community as a way to understand Korean Apple ... uses a Korean MacBook user community to understand Korean Apple consumer culture and the meanings of the brand in the local context Exploring members’ self-presentation performance and their...
- 93
- 362
- 0
Tài liệu Báo cáo Y học: Exploring the role of a glycine cluster in cold adaptation of an alkaline phosphatase pdf
... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzyme (Table 1) Thermal inactivation ... dimensional model of the wild type (A) and mutant alkaline phosphatases G26 1A (B) and G26 1A /Y2 6 9A (C); only residues that where studied are shown respectively By introducing an Ala residue in the place...
- 6
- 488
- 0
báo cáo hóa học: " Struggles, strengths, and strategies: an ethnographic study exploring the experiences of adolescents living with an ostomy" doc
... to them and make them feel as if they are needed, and to address their problems When you have an illness in the family it takes away from a lot of the other siblings, and they also need care ." ... go with the flow more now, you know Whatever comes up I can handle it " Adolescents identified adaptive strategies and means of coping with their circumstances Some identified the importance of ... surveillance and/ or care for the adolescent with the ostomy and j-pouch As an example, a participant described the role of her friends during times of recreation "I even go swimming with my friends and...
- 8
- 418
- 0
The culture of the Renaissance
... theatrical company and worked as an actor and a playwright In the late 90s a new theatre called The Globe was built on the bank of the Thames Shakespeare became one of its owners The people of ... including the tragedy “Hamlet, Prince of Denmark.” Shakespeare’s Hamlet is a complex play where many themes are intertwined – themes that are essential to the development of the play The issue of death ... Analysis The play is introduced by the appearance of the ghost of Hamlet’s father in the first scene, which automatically gives the impression that something is amiss This is later clarified by the...
- 10
- 329
- 0
Tài liệu NUCLEAR PHYSICS: EXPLORING THE HEART OF MATTER ppt
... Nuclear Physics: Exploring the Heart of Matter NUCLEAR PHYSICS: EXPLORING THE HEART OF MATTER The Committee on the Assessment of and Outlook for Nuclear Physics Board on ... small fraction of the mass of the visible matter in the universe So, the origin of 99 percent of the mass of the visible matter in the universe can be traced back to the energy of moving quarks ... Heart of Matter Box 1.1 The Fundamental Matter Particles of the Standard Model, also sometimes called The Theory of Visible Matter FIGURE 1.1.1 The masses of particles The vertical scale is the...
- 264
- 591
- 0
Tài liệu Gravitational Physics: Exploring the Structure of Space and Time pdf
... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME • Measure the temperature ... precession of the orbit of Mercury and the bending of light by the Sun Over the ensuing decades theoretical analyses deepened the understanding of the theory and exhibited the richness and variety of...
- 129
- 573
- 0
Tài liệu Exploring the challenges of HIV- AIDS docx
... during the implementation phase of the project 11 EXPLORING THE CHALLENGES OF HIV /AIDS Progress in SADC countries The Healthy Relationships intervention component Over the past two years each of the ... Researcher in the office of the CEO at the Human Sciences Research Council in Cape Town At the time of writing, Kristin Roe was a CIDA-funded intern with the Social Aspects of HIV /AIDS Research ... supports the role of the continent in its effort to deal with HIV /AIDS in Africa He raised the question of whether evidence from research undertaken is translated into advocacy and 19 EXPLORING THE CHALLENGES...
- 79
- 376
- 0
Tài liệu SPACE, TIME, FRAME, CINEMA EXPLORING THE POSSIBILITIES OF SPATIOTEMPORAL EFFECTS pdf
... direction Each frame, then, has a minimum width (along the spatial axis) representing the amount of space captured in the frame, due to the field of view of the lens and the width of the frame itself, ... On the far left side of the frame, which is the narrowest, the exposure time is the shortest and the bar is sharpest and has the least amount of motion blur As we move across the frame to the ... (on the left) vs a frame with a nodal line (on the right) The idea of the spatial long exposure results from interchanging the axes of space and time We have also seen how the slanting of the...
- 13
- 451
- 0
Tài liệu Báo cáo khoa học: "Exploring the Use of Linguistic Features in Domain and Genre Classification" potx
... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war- 145 den" in German, and the use of present ... (auxiliary "haben') In this corpus, texts from the domains of law and economy contain more VAINF than others The potential meaning of common punctuation marks is quite clear: the longer the sentences...
- 8
- 689
- 1
Gravitational Physics Exploring the Structure of Space and Time docx
... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME • Measure the temperature ... Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 12 GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME III OPPORTUNITIES FOR THE NEXT...
- 128
- 480
- 0
Báo cáo khoa học: A family of killer toxins Exploring the mechanism of ADP-ribosylating toxins pptx
... eEF2–PAETA complex (Asp696 of EF2) This aspartate interacts with the 2-OH of ADP ribose in a manner similar to that of the catalytic glutamate of the ADPRT and this could be essential to the mechanism ... endosomes, the low pH activates the translocation function of the B domain heptamers and they translocate the catalytic A domains across the endosomal membrane into the cytoplasm where they can act ... nearly all of the C3-like and Iota-like ADPRTs These are: (a) a tyrosine residue that interacts with the ‘S’ of the STS motif and the catalytic glutamate through hydrogen bonds, (b) an asparagine...
- 15
- 333
- 0
Báo cáo khoa học: "Exploring the Potential of Intractable Parsers" pdf
... with the following parameters L consisted of three labeling schemes: the set L wd of word labels, the set Lpt of preterminal labels, and the set Lnt of nonterminal labels The order < of the model ... guarantees The central question driving this paper is whether we can jettison these guarantees and still obtain good performance in practice For the decoding of the probabilistic model of the previous ... and test sets with an off -the- shelf tagger, namely the Brill tagger (Brill, 1994) Thus the object of our computation was HLPD ECODE(H, n, w), where n was the length of the sentence, and partial...
- 8
- 352
- 0
Báo cáo khoa học: "Exploring the Characteristics of Multi-Party Dialogues" docx
... For example, are there any possibilities if in multi-party dialogues the role of chairpersons emerges from the nature of the dialogues? These are not only problems in exploring multi-party dialogues ... behaviour of Japanese in shopping situations between a shop assistant and two customers They relate various characteristics of their dialogue data such as the number of utterances, the types of information ... examine whether there are differences of the number of characters and turns between speakers The results indicates that there are statistically no differences at 05 level to the number of characters...
- 7
- 433
- 0
Từ khóa: discussed we strive to promote the culture of internal managerial control as an extremenly important element of the quality and excellence commitment in universitiesthey also serve as important documents providing information about the culture of the community visited by the writer as with other literary genres the genre of malaexploring the structure of complex software designsjust a theory exploring the nature of science pdfancient egyptian tombs the culture of life and deathexploring the laws of motion post quizexploring the laws of motion program quizexploring the laws of motion program quiz answersthe resistor in an rc circuit has a resistance ofexploring the heart of matterdance movement therapy exploring the dance of connectionthe culture of technology savants context and perspectiveslargeregions exploring the roles of nesting and subsidiaritychanging the culture of independenceexploring the impact of bilateral investment treaties on foreign direct investment flowsBáo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ