Exploring the culture of an online brand community a study of a korean apple macbook user community

... style for the brand In particular, a significant number of brand photos and conversations about the images develop the meaning of the MacBook brand as an urban fashion icon Figure Spending calming ... However, there have been few attempts to examine Korean Apple users’ experiences of online brand communities This study therefore chose a Korean MacBook...

Ngày tải lên: 05/10/2015, 22:16

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

... to them and make them feel as if they are needed, and to address their problems When you have an illness in the family it takes away from a lot of the other siblings, and they also need care ." ... go with the flow more now, you know Whatever comes up I can handle it " Adolescents identified adaptive strategies and means of coping with their circumstances Some...

Ngày tải lên: 18/06/2014, 19:20

... theatrical company and worked as an actor and a playwright In the late 90s a new theatre called The Globe was built on the bank of the Thames Shakespeare became one of its owners The people of ... including the tragedy “Hamlet, Prince of Denmark.” Shakespeare’s Hamlet is a complex play where many themes are intertwined – themes that are essential to the development of...

Ngày tải lên: 18/04/2013, 13:36

... Nuclear Physics: Exploring the Heart of Matter NUCLEAR PHYSICS: EXPLORING THE HEART OF MATTER The Committee on the Assessment of and Outlook for Nuclear Physics Board on ... small fraction of the mass of the visible matter in the universe So, the origin of 99 percent of the mass of the visible matter in the universe can be traced...

Ngày tải lên: 12/02/2014, 16:20

... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL...

Ngày tải lên: 12/02/2014, 16:20

... during the implementation phase of the project 11 EXPLORING THE CHALLENGES OF HIV /AIDS Progress in SADC countries The Healthy Relationships intervention component Over the past two years each of the ... Researcher in the office of the CEO at the Human Sciences Research Council in Cape Town At the time of writing, Kristin Roe was a CIDA-funded intern with t...

Ngày tải lên: 18/02/2014, 23:20

... direction Each frame, then, has a minimum width (along the spatial axis) representing the amount of space captured in the frame, due to the field of view of the lens and the width of the frame itself, ... On the far left side of the frame, which is the narrowest, the exposure time is the shortest and the bar is sharpest and has the least amount of...

Ngày tải lên: 19/02/2014, 10:20

Ngày tải lên: 21/02/2014, 16:20

... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...

Ngày tải lên: 22/02/2014, 03:20

... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL PH...

Ngày tải lên: 14/03/2014, 10:20

... eEF2–PAETA complex (Asp696 of EF2) This aspartate interacts with the 2-OH of ADP ribose in a manner similar to that of the catalytic glutamate of the ADPRT and this could be essential to the mechanism ... endosomes, the low pH activates the translocation function of the B domain heptamers and they translocate the catalytic A domains across the endosomal membr...

Ngày tải lên: 30/03/2014, 10:20

... with the following parameters L consisted of three labeling schemes: the set L wd of word labels, the set Lpt of preterminal labels, and the set Lnt of nonterminal labels The order < of the model ... guarantees The central question driving this paper is whether we can jettison these guarantees and still obtain good performance in practice For the decoding of the...

Ngày tải lên: 31/03/2014, 01:20

... For example, are there any possibilities if in multi-party dialogues the role of chairpersons emerges from the nature of the dialogues? These are not only problems in exploring multi-party dialogues ... behaviour of Japanese in shopping situations between a shop assistant and two customers They relate various characteristics of their dialogue data such as the number of...

Ngày tải lên: 31/03/2014, 04:20