Exploring the chinese blogosphere the motivations of blog authors readers

... will be: RQ1 What are Chinese blog readers motivations to read blogs? RQ2 What aspects of blogs Chinese readers find interesting? Why? RQ3 What are the motivations of Chinese bloggers to establish ... Although there is no exact definition of blog, it does not hinder the number of blogs from constantly growing In the big family of all kinds of blogs, there are...

Ngày tải lên: 05/10/2015, 22:16

... Nuclear Physics: Exploring the Heart of Matter NUCLEAR PHYSICS: EXPLORING THE HEART OF MATTER The Committee on the Assessment of and Outlook for Nuclear Physics Board on ... small fraction of the mass of the visible matter in the universe So, the origin of 99 percent of the mass of the visible matter in the universe can be traced...

Ngày tải lên: 12/02/2014, 16:20

... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL...

Ngày tải lên: 12/02/2014, 16:20

... during the implementation phase of the project 11 EXPLORING THE CHALLENGES OF HIV /AIDS Progress in SADC countries The Healthy Relationships intervention component Over the past two years each of the ... Researcher in the office of the CEO at the Human Sciences Research Council in Cape Town At the time of writing, Kristin Roe was a CIDA-funded intern with t...

Ngày tải lên: 18/02/2014, 23:20

... direction Each frame, then, has a minimum width (along the spatial axis) representing the amount of space captured in the frame, due to the field of view of the lens and the width of the frame itself, ... On the far left side of the frame, which is the narrowest, the exposure time is the shortest and the bar is sharpest and has the least amount of...

Ngày tải lên: 19/02/2014, 10:20

Ngày tải lên: 21/02/2014, 16:20

... assigned the class of the majority of the items which reached it during training The trees were grown using recursive partitioning; the splitting criterion was reduction in deviance Using the Gini index ... texts of argumentative types The frequency of infinitives of auxiliaries reflects both the use of passive voice, which is formed with the auxiliary "war-...

Ngày tải lên: 22/02/2014, 03:20

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... value almost 2.5-fold higher than the native cold adapted enzyme (Table 1) The mutant G26 1A /Y2 6 9A exhibits an Ea almost the same as in the case of the native enzy...

Ngày tải lên: 22/02/2014, 04:20

... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html GRAVITATIONAL PHYSICS: EXPLORING THE STRUCTURE OF SPACE AND TIME ing field of gravitational ... reserved Gravitational Physics: Exploring the Structure of Space and Time http://www.nap.edu/catalog/9680.html 22 GRAVITATIONAL PH...

Ngày tải lên: 14/03/2014, 10:20

... eEF2–PAETA complex (Asp696 of EF2) This aspartate interacts with the 2-OH of ADP ribose in a manner similar to that of the catalytic glutamate of the ADPRT and this could be essential to the mechanism ... endosomes, the low pH activates the translocation function of the B domain heptamers and they translocate the catalytic A domains across the endosomal membr...

Ngày tải lên: 30/03/2014, 10:20

... with the following parameters L consisted of three labeling schemes: the set L wd of word labels, the set Lpt of preterminal labels, and the set Lnt of nonterminal labels The order < of the model ... guarantees The central question driving this paper is whether we can jettison these guarantees and still obtain good performance in practice For the decoding of the...

Ngày tải lên: 31/03/2014, 01:20

... For example, are there any possibilities if in multi-party dialogues the role of chairpersons emerges from the nature of the dialogues? These are not only problems in exploring multi-party dialogues ... behaviour of Japanese in shopping situations between a shop assistant and two customers They relate various characteristics of their dialogue data such as the number of...

Ngày tải lên: 31/03/2014, 04:20

Ngày tải lên: 08/05/2014, 12:52