Environmental damage schedules the response to public allocation decisions
... scales17, is called the ‘understandability factor’ Similar to the first factor, the lay people is found to have a much smaller range (-1.18 to 1.00) compared to the experts (-2.03 to 2.24) Both groups ... for the most part, have proven to be unreliable and ambiguous guides to public resource allocation decisions and damage compensation This thesis offers instea...
Ngày tải lên: 05/10/2015, 21:24
... thioredoxins were found In this study we examined the involvement of the peroxiredoxin Bcp2 in oxidative stress in the hyperthermophilic aerobic archaeon Sulfolobus solfataricus Furthermore, ... clarified in detail and could play a key role in the detoxification processes In this study we examined the role of Bcp2 in order to increase the knowledge...
Ngày tải lên: 07/03/2014, 12:20
... Overall, there are a series of situations where CTXII behaves distinctly to other markers The present study adds to these series the unique response of CTX-II to oestrogen deficiency There are many ... investigates whether these collagen degradation products may relate to the breakdown of newly synthesised collagen, because collagen synthesis is reported...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "The response to oestrogen deprivation of the cartilage collagen degradation marker, CTX-II, is unique compared with other markers of collagen turnover" doc
... Overall, there are a series of situations where CTXII behaves distinctly to other markers The present study adds to these series the unique response of CTX-II to oestrogen deficiency There are many ... investigates whether these collagen degradation products may relate to the breakdown of newly synthesised collagen, because collagen synthesis is reported...
Ngày tải lên: 09/08/2014, 13:22
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... d It can be shown that the conditional expectation of a performance future offspring of some animal i of the parent population is equal to and the variance given the performances of all the ,i ... ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are submatrices of equation (44) Note that all the individuals in the analysis are inv...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: " Airway obstruction in asthma: does the response to a deep inspiration matter" pptx
... a dilatory response in the asthmatic might be that myosin bridges never see strains that large This is perhaps because the majority of the mechanical strain in the asthmatic airway during a DI ... individuals fails in asthmatics Bridge dynamics and plastic reorganization of the cytoskeleton are surely important factors, but how they interact and details about underlyin...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: "Clinical review: Communication and logistics in the response to the 1998 terrorist bombing in Omagh, Northern Ireland" potx
... concerned were mainly medical trainees in anaesthesia (who are used to working in the ED and frequently move from one hospital to another as part of their training) and ED nurses Working within an appropriate ... Lavery and Horan Table The system’s response to bombing: strengths and weaknesses Strengths in system’s response Weaknesses in system’s response Clin...
Ngày tải lên: 12/08/2014, 22:21
Báo cáo y học: "How can the response to volume expansion in patients with spontaneous respiratory movements be predicted" ppsx
... spontaneous respiratory movements, so that the number of cardiac beats per respiratory cycle may be reduced, and hence the chance to detect respiratory variations in stroke volume Finally, patients ... study indicates that the capacity of ∆PP to predict changes in cardiac index during fluid challenge is inaccurate in the presence of spontaneous respiratory...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects telome...
Ngày tải lên: 14/08/2014, 21:20
A study of bloating symptomatology, the role of gastrointestinal transit and the response to treatment with the 5 HT4 receptor agonist in patients with bloating predominant irritable bowel syndrome
... antagonizing the 5- HT3 receptor slows intestinal transit and that agonizing the 5- HT4 receptor accelerates gastrointestinal transit These observations have led to increased efforts to develop and ... symptomatology of bloating, the role of gastrointestinal transit and effect of tegaserod in non-diarrhea IBS patients with bloating In the...
Ngày tải lên: 26/09/2015, 10:05
Báo cáo khoa học: Functional studies of crustacean hyperglycemic hormones (CHHs) of the blue crab, Callinectes sapidus – the expression and release of CHH in eyestalk and pericardial organ in response to environmental stress pot
... Hemolymph titers of PO -CHH and ES -CHH in response to changes in dissolved oxygen Hypoxia induced the release of CHHs from the PO and ES of the juvenile crabs (Fig 6) At the initial control normoxic ... of CHH cDNA from the ES [28] Also, we examined the physiological responses of the release and expression of these two CHHs under stressful co...
Ngày tải lên: 16/03/2014, 06:20
báo cáo khoa học: " Public health the leading force of the Indonesian response to the HIV/AIDS crisis among people who inject drugs" doc
... and the role of IHPCP The Indonesian response to the HIV/AIDS crisis among people who inject drugs is still modest There is a clear consensus among stakeholders of an urgent need to scale up the ... is to increase the number of drug users treated to more than 50,000 by 2010 These public health centres are targeting to reach another 23,000 peopl...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo y học: " Factors affecting the long-term response to tacrolimus in renal transplant patients: Pharmacokinetic and pharmacogenetic approac"
... biological factors known to affect pharmacokinetics are the drug transporters and the metabolizing enzymes [7,9] CYP3A, the primary subfamily of the cytochrome P450 (CYP) enzymatic system, is ... Heiden IP, et al Genetic polymorphisms of the CYP3A4, CYP3A5, and MDR-1 genes and pharmacokinetics of the calcineurin inhibitors cyclosporine and tacrolimus Clin Pharmacol T...
Ngày tải lên: 26/10/2012, 09:32