Development of suntool prototype for sunlight shadow study in architecture immersive visualization
... use it for sunlight study in modelling software during the conceptual design process Figure 2-8: OKINO Sunlight Study Plug -In System - Time GUI (www.okino.com) Figure 2-9: OKINO Sunlight Study ... DEVELOPMENT OF SUNTOOL PROTOTYPE FOR SUNLIGHT/ SHADOW STUDY IN ARCHITECTURE IMMERSIVE VISUALIZATION ANGGORO, RONI ( B.Arch., Petra Christian University) A TH...
Ngày tải lên: 04/10/2015, 15:58
... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Sp...
Ngày tải lên: 29/03/2014, 23:20
... and 15% of the mean, whereas for 33 Development of an approach for interface pressure measurement and analysis for study of sitting the CONFORMat, the standard deviation was around 3% and 7% In ... work and puts forth recommendations and future work Development of an approach for interface pressure measurement and analysis for stu...
Ngày tải lên: 04/10/2015, 15:52
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... out of the earth 'And wine that maketh glad the heart of man The Development of the Feeling for Nature in the Middle Ages and Modern Times 'The trees of the Lord are full of sap; the cedars of ... life, of mind, mood, and feeling, The Development of the Feeling for Nature in the Middle Ages and Modern Times which...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefo...
Ngày tải lên: 08/03/2014, 21:20
Báo cáo khoa học: "Demonstration of a prototype for a Conversational Companion for reminiscing about images" doc
... interfaces for the Dialogue Action Forms (DAF) to use It has an easyto-use high-level interface for general DAF designers to code associated tests and actions as well as a low level interface for advanced ... ability of the system to handle more than one kind of application at a time, and news has, of course, an unconstrained vocabulary The following is a fairly typical exam...
Ngày tải lên: 23/03/2014, 16:20
the development of ethics a historical and critical study volume ii from suarez to rousseau sep 2008
... of Natural Law Our Knowledge of Natural Law Application of the Precepts Divine Dispensations from the Natural Law? The Natural Law and the Law of Nations Natural Law and the Basis of Political ... broad use of ‘measure’ and ‘rule’, and asserts that Aquinas would not speak of a law in all these cases (ii 5.6, citing Aquinas, ST 2–2 q141 a6 and ad1) Both...
Ngày tải lên: 11/06/2014, 10:28
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... evaluate the therapeutic potential of expression vectors carrying the "A" fragment of the diphtheria toxin (DT -A) gene under the control of the H19 regulatory sequences in an ovarian carcinoma ... expression profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA -H19 vector was tested in a rat ani...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Development of targeted therapy for bladder cancer mediated by a double promoter plasmid expressing diphtheria toxin under the control of H19 and IGF2-P4 regulatory sequences" potx
... an approach for targeted therapy of bladder carcinoma by driving the DTA expression under the control of IGF2-P4 and H19 regulatory sequences To evaluate the possible use of IGF2-P4 and H19 regulatory ... therapy is an attractive approach Based on early studies of our group and others, the transcriptional regulatory sequences of the H19...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...
Ngày tải lên: 20/06/2014, 01:20
Card Project VIE: Sustainable and profitable development of acacia plamtations for sawlog production in Vietnam " ppt
Ngày tải lên: 21/06/2014, 06:20
Collaboration for Agriculture & Rural Development:Sustainable and profitable development of acacia plantations for sawlog production in Vietnam - Milestone 12 " pdf
... phân bón) singling young acacia plantations to produce single-stemmed 12 11 - - - - - - - trees, 3-6 months after planting (tỉa bỏ để lại thân sau – tháng trồng) form-pruning young acacia plantations ... khác?) 7 - nursery management and seedling production (quản lý vườn ươm thu hái hạt) - - - - - - - plantation establishment (si...
Ngày tải lên: 21/06/2014, 06:20