Development of micro total analysis system for detection of water pathogens

... DEVELOPMENT OF MICRO TOTAL ANALYSIS SYSTEM FOR DETECTION OF WATER PATHOGENS Yong Chee Kien (B.Eng (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DIVISION OF ENVIRONMENTAL ... System 151 viii NUS DESE Summary SUMMARY The objective of this project is to develop a micro total analysis system for water pathogen detection Th...

Ngày tải lên: 04/10/2015, 15:57

... DEVELOPMENT OF FRINGE ANALYSIS TECHNIQUES IN WHITE LIGHT INTERFEROMETRY FOR MICRO- COMPONENT MEASUREMENT BY LI MINGZHOU (M Eng.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... in Fourier transform 1.3 Scope of work The main objective of the study is to investigate new measurement techniques in the evaluation of micro- components using v...

Ngày tải lên: 14/09/2015, 14:12

... DEVELOPMENT OF A GRAPHIC USER INTERFACE BASED ON OPENGL FOR A DROP -ON- DEMAND MICRO/ BIO FABRICATION SYSTEM CHEN JUEXUAN (Ms.) (B.Eng.), HUST A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING ... additional functions for the GUI, simulation and monitoring based on OpenGL As a common graphic interface developed by SGI [23], Open...

Ngày tải lên: 04/10/2015, 15:46

... index for assessment of the overall performance of office buildings The objectives of the study are:- To develop a holistic framework based on the TBP approach for the assessment of office buildings ... various building performance indicators The Total Building Performance concept is adopted as the basic framework to develop an integrated index for asses...

Ngày tải lên: 04/10/2015, 15:58

... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...

Ngày tải lên: 05/09/2013, 16:11

... method, which can transmit the view of forks’ environment in term of force feedback information, and we named it as observe-by-wire system The essential components of an OBW system are distance sensors ... Rossetter, Ian A Coe, J Christian Gerdes “Handwheel Force Feedback for Lanekeeping Assistance: Combined Dynamics and Stability,” American Society of Mechanical Engineers -...

Ngày tải lên: 17/12/2013, 11:15

... method, which can transmit the view of forks’ environment in term of force feedback information, and we named it as observe-by-wire system The essential components of an OBW system are distance sensors ... Rossetter, Ian A Coe, J Christian Gerdes “Handwheel Force Feedback for Lanekeeping Assistance: Combined Dynamics and Stability,” American Society of Mechanical Engineers -...

Ngày tải lên: 23/12/2013, 00:15

... method, which can transmit the view of forks’ environment in term of force feedback information, and we named it as observe-by-wire system The essential components of an OBW system are distance sensors ... Rossetter, Ian A Coe, J Christian Gerdes “Handwheel Force Feedback for Lanekeeping Assistance: Combined Dynamics and Stability,” American Society of Mechanical Engineers -...

Ngày tải lên: 22/01/2014, 02:20

... d) after 12 days in Ha Long Bay area: a, b - SE wind, c, d - NE wind Development of system of hydrodynamic-environmental models for coastal area 65 The field sampling results in September 2005 ... 1/2003, pp 10 8-1 13 (in Vietnamese) [7] Dinh Van Uu et al (2005), Application of the 3D water circulation model for studying SPM transport processes in Quang...

Ngày tải lên: 13/02/2014, 12:20

... number of different names and name types for one chemical compound, namely several systematic, semi-systematic, trivial and trade names For example, pentan-2-ol is the recommended name for the compound ... architecture of CLP(name2structure), a system for semantic and syntactic processing of chemical compound names In the introductory section, we described the chara...

Ngày tải lên: 08/03/2014, 01:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGT...

Ngày tải lên: 16/03/2014, 01:20

... synthesis enhanced by T7 RNA polymerase Prior to the preparation of 15N-labelled samples of hCypA and analysis by NMR spectroscopy, the performance of the cell-free expression system was explored ... 2004 Cell-free synthesis of 15 N-labelled proteins (Eur J Biochem 271) 4087 Optimization of other conditions for in vitro protein synthesis Fig Cell-free...

Ngày tải lên: 16/03/2014, 18:20

... evolution of public sentiment toward the contenders Conclusion We presented a system for real-time Twitter sentiment analysis of the ongoing 2012 U.S presidential election We use the Twitter “firehose” ... aggregate sentiment and tweet volume within each time period for each candidate For volume, the system outputs the number of tweets every minute for each c...

Ngày tải lên: 16/03/2014, 20:20

... present  the results  of an  application  of MCA  to find  out  the most  feasible measures for sustainable development of the brackish water shrimp culture in Quang Tri Province. The application of MCA  ... pond  area  in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has  increased  approximately 4 times, from 251 ha in 2000 to 902.5 ...

Ngày tải lên: 22/03/2014, 12:20

... implementation of a setup of the DYMOS system for simulating and visualizing atmospheric pollution in Santiago have started to be taken In order to apply the system DYMOS to forecast the level of pollutants ... functionalities for simulation, prediction and visualization of air pollution, must be considered as complementary to the available models and as...

Ngày tải lên: 23/03/2014, 04:20