Development of EEG method for mental fatigue measurement
... differentiated mental fatigue from physical fatigue He defined that physical fatigue is concerned on the reduced muscular system performance; mental fatigue deals with much reduced mental performance, ... performance versus time of day, Subjects 45 Table 5.2 Day 1’s AVT performance vs Day 2’s AVT performance (%) 45 Table 5.3 Average AVT performance (%) for higher performers...
Ngày tải lên: 04/10/2015, 15:52
... on EEG, standard EEG signal processing methods, and the detailed review of the past related work on EEG- based mental fatigue monitoring Some formulations of the relevant signal processing methods ... 2.6 Mental- Fatigue Basics 30 methods in collecting mental- fatigue EEG database used for EEG- based mental- fatigue measurement methods This will be c...
Ngày tải lên: 14/09/2015, 14:02
... degradation Additional data file contains the original data used to perform this analysis and is available with the online version of this paper interactions Additional data files refereed research ... monoclonal antibody against the Myc epitope (Sigma), a polyclonal antibody against G protein (Santa Cruz) or an antibody against Hsp70 (Santa Cruz) Bands were visualized with SuperSignal We...
Ngày tải lên: 14/08/2014, 14:21
Development of an approach for interface pressure measurement and analysis for study of sitting
... and 15% of the mean, whereas for 33 Development of an approach for interface pressure measurement and analysis for study of sitting the CONFORMat, the standard deviation was around 3% and 7% In ... work and puts forth recommendations and future work Development of an approach for interface pressure measurement and analysis for stu...
Ngày tải lên: 04/10/2015, 15:52
báo cáo khoa học: " Panorametry: suggestion of a method for mandibular measurements on panoramic radiographs" potx
... radiography Image of8 panorametry traced bone-dental angular measureImage of panorametry traced over a panoramic radiography with information for bilateral bone-dental angular measurements of the mandible ... Proposta de metodologia para traçado maxilar inferior em radiografia panorâmica: panorametria Ortod Gaúcha 2004, 8:4-10 Akcam MO, Altiok T, Ozdiler E: Panoramic radiograph...
Ngày tải lên: 11/08/2014, 20:20
Development and validation of analytical method for naftopidil in human plasma by LC–MSMS
... Development and validation of analytical method for Naftopidil in human plasma by LC–MS/MS 649 for sample processing, and a high injection volume, but still no LC–MS/MS method has ... chromatograms (a) chromatogram of blank plasma, (b) chromatogram of blank + IS, (c) chromtogram of LLOQ Development and validation of analytical method for Naf...
Ngày tải lên: 02/09/2015, 13:48
Development of a method to measure consumer emotions associated with foods
... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...
Ngày tải lên: 03/04/2013, 21:07
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... develop a controller for temperature control inside a room within a desired band of temperatures for comfort The details of the geometry of the room and the HVAC system based on displacement ventilation ... disadvantages of the DMC controller First, the DMC controller is a local controller which can only guarantee the stability of the...
Ngày tải lên: 05/09/2013, 16:11
Tài liệu Handbook of Clinical Sexuality for Mental Health Professionals docx
... Handbook of Clinical Sexuality for Mental Health Professionals HANDBOOK OF CLINICAL SEXUALITY FOR MENTAL HEALTH PROFESSIONALS Stephen B.Levine, MD Editor Candace B.Risen, LISW Stanley E.Althof, ... discovered Within these 30 HANDBOOK OF CLINICAL SEXUALITY FOR MENTAL HEALTH PROFESSIONALS two basic forms, there are countless degrees of self-disc...
Ngày tải lên: 15/02/2014, 02:20
Tài liệu The Development of the Feeling for Nature in the Middle Ages and Modern Times doc
... out of the earth 'And wine that maketh glad the heart of man The Development of the Feeling for Nature in the Middle Ages and Modern Times 'The trees of the Lord are full of sap; the cedars of ... life, of mind, mood, and feeling, The Development of the Feeling for Nature in the Middle Ages and Modern Times which...
Ngày tải lên: 21/02/2014, 20:20
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " The Development of Lexical Resources for Information Extraction from Text Combining Word Net and Dewey Decimal Classification" potx
... ambiguity in WordNet by combining its information with another source of information: the Dewey Decimal Classification (DDC) (Dewey, 1989) Reducing the lexical ambiguity in W o r d N e t The main ... greatly reduce the ambiguity implied by the use of WordNet by finding the correct set of field labels that cover all the WordNet hierarchy in an uniform way Therefo...
Ngày tải lên: 08/03/2014, 21:20
Improving the Quality of Health Care for Mental and Substance-Use Conditions doc
... of the Department of Veterans Affairs for their support for the application of the Quality Chasm framework as a tool for improving the quality of health care for mental and substance-use conditions, ... to Mental Health and Addictive Disorders Improving the quality of health care for mental and substance-use conditions / Com...
Ngày tải lên: 22/03/2014, 16:21
DEVELOPMENT OF STUDENTS’ ENGLISH FOR SPECIAL PURPOSES COMPETENCE IN TOURISM STUDIES AT TERTIARY LEVEL potx
... determine students’ ESP Development of students’ English for Special Purposes competence in tourism studies at tertiary level Dr Ineta Luka, School of Business Administration Turiba, Latvia 13 competence ... stage of the research to create the model for the development of students’ ESP competence Development of students’ English for Sp...
Ngày tải lên: 29/03/2014, 23:20
báo cáo hóa học:" Development of targeted therapy for ovarian cancer mediated by a plasmid expressing diphtheria toxin under the control of H19 regulatory sequences" doc
... evaluate the therapeutic potential of expression vectors carrying the "A" fragment of the diphtheria toxin (DT -A) gene under the control of the H19 regulatory sequences in an ovarian carcinoma ... expression profiling allows an individualized DNA-base approach to cancer therapy The therapeutic potential of the DTA -H19 vector was tested in a rat ani...
Ngày tải lên: 18/06/2014, 15:20