Development of digital image correlation method for displacement and shape measurement

... algorithm development and applications of DIC method vi LIST OF FIGURES LIST OF FIGURES Fig 3.1 Typical set-up for digital image correlation 28 Fig 3.2 Typical images (a) before and (b) after a deformation ... in Digital Image Correlation 15 ii TABLE OF CONTENTS 3.2 Principle for Out -of- Plane Displacement Measurement 17 3.3 Principle for Shape Measur...

Ngày tải lên: 04/10/2015, 15:52

... Schematic diagram of planar deformation process 35 Chapter Application of Fringe Projection Method for Static Measurement This chapter describes the fringe projection method for static profile measurement ... static and dynamic loading conditions Experimental verification for both static shape measurement and dynamic analysis is carried out on a m...

Ngày tải lên: 04/10/2015, 15:46

... archaebacteria Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ Candidatus ‘Accumulibacter phosphatis’ ... Quantitative PCR and FISH method in Activated sludge The amount of Candidatus ‘Accumulibacter phosphatis’ in the la...

Ngày tải lên: 05/09/2013, 09:38

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAAGA) and allelespecific primers Pnf (AGCATTTGGTTTTAAATTATGGAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA) The PCR was run for 35 cycles with each cycle ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelof...

Ngày tải lên: 10/08/2014, 21:23

... is an active method that may be used to directly evaluate the liquefaction resistance of soils in place The test is based on the premise of dynamically loading a native soil deposit in a manner ... me vi Development of a Direct Test Method for Dynamically Assessing the Liquefaction Resistance of Soils In Situ Publication No. _ Brad...

Ngày tải lên: 14/11/2014, 13:09

... Fundamentals of the Finite Element Method for Heat and Fluid Flow Fundamentals of the Finite Element Method for Heat and Fluid Flow Roland W Lewis University of Wales Swansea, ... , the mass of the wall of the bulb; cpw , the specific heat of the wall; hf , the heat transfer coefficient between the filament and the gas; hg...

Ngày tải lên: 17/03/2014, 13:53

... uses of the Monte Carlo are for the purposes of understanding physical phenomena There are others uses of the Monte Carlo method for purely mathematical reasons, such as the determination of multi-dimensional ... probability theory Fundamental to understanding the operation of a Monte Carlo process and interpreting the results of Monte Carlo cal...

Ngày tải lên: 09/04/2014, 16:23

... DEVELOPMENT OF LIQUID CRYSTAL- BASED SYSTEM FOR BIOMOLECULE AND NANOMATERIAL CHARACTERIZATION DENY HARTONO (BEng, Institut Teknologi Bandung, Indonesia) A THESIS SUBMITTED FOR THE DEGREE OF ... types of LCs based on the shape of LC molecules: (A) calamitic and (B) discotic Source: Liquid Crystal Technology Group, Oxford University Based on the driving fo...

Ngày tải lên: 14/09/2015, 08:41

... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak depe...

Ngày tải lên: 14/09/2015, 10:36

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

... case of SR ARQ, the number of retransmissions of a packet is a random number between and Ntr Therefore, the latency and overhead resulting from SR ARQ are also random, with a maximum value determined ... rise to a fixed overhead and latency that are determined by the parameters of the RS code In the case of SR ARQ, the instantaneous overhead and latency are random; th...

Ngày tải lên: 21/06/2014, 22:20

Ngày tải lên: 29/11/2014, 07:05

... that make it acts as an open circuit and also the tank circuit appears to be a Design and Development of a CMOS Power Amplifier for Digital Applications 34 CHAPTER 3: Fundamentals of Power Amplifier ... Scattering Design and Development of a CMOS Power Amplifier for Digital Applications 40 CHAPTER 4: Power Amplifier: Design Implementa...

Ngày tải lên: 04/10/2015, 10:25

... Triaxial Testing System, Advanced Triaxial Testing of Soil and Rock, American Society for Testing Materials - Special Technical Publication, ASTM STP 977, pp 82-94, (1988) [6] Miwa Koichi, Nanba ... Itsuo and Tsuneyoshi Akihiko, On the Real Time Processing System for Triaxial Compression Test of Soil, Bulletin of the Faculty of Agriculture, Kagoshima University, p.211-...

Ngày tải lên: 10/12/2013, 06:15

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20