Daylight operation of a free space, entanglement based quantum key distribution system

... that a hacking attempt based on a measurement of the distributed qubit can be observed as an increasing error ratio in the raw key bits that are distributed Information leakage may be estimated ... Stamp Measure and Time Stamp Public communication Initial Key Initial Key Privacy Amplification (PA) Privacy Amplification (PA) Message Message Figure 1.1: Layout of the Quantum...

Ngày tải lên: 04/10/2015, 10:25

... Speaking of a Free Press 200 Years of Notable Quotations About Press Freedoms Published by American Newspaper Association Foundation (Now The Newspaper Association of America Foundation) ... ‘freedom of speech,’ ‘freedom of press and free assembly’ are just rhetorical myths I believe rather that they are among the most valuable realities that men have gained, and that if...

Ngày tải lên: 16/01/2014, 22:20

... automatically enrich the output of a parser with information that is not provided by the parser itself, but is available in a treebank Using the method with two state of the art statistical parsers and ... labelling, but they are not available in the output of other parsers As an alternative to hardcoded heuristics, Blaheta and Charniak (2000) proposed to recover...

Ngày tải lên: 08/03/2014, 04:22

... inverse The increase of photon intensity of one mode makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two-mode random microlaser ... operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation of mode photon densitie...

Ngày tải lên: 14/03/2014, 13:20

... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach- Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and...

Ngày tải lên: 15/03/2014, 09:20

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

... the standard of value still another 'The dollar is the measure of value Silver and gold at a certain degree of fineness, are the standard of value The bill of a Mutual Bank is a bill of exchange, ... serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and not an actual one, cannot serve as a standard of val...

Ngày tải lên: 29/03/2014, 08:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 18/06/2014, 18:20

... Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomized clinical trial in patients with acquired brain injury Journal of NeuroEngineering and Rehabilitation ... Access Effectiveness of a Wii balance board-based system (eBaViR) for balance rehabilitation: a pilot randomi...

Ngày tải lên: 19/06/2014, 08:20

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 20/06/2014, 01:20

... problem with a bifunction defined on the dual space of a Banach space Proceeding of the 8th International Conference on Fixed Point Theory and its Applications pp 197–209.Yokohama Publish:Yokohama ... Cite this article as: Chen et al.: Shrinking projection algorithms for equilibrium problems with a bifunction defined on the dual space...

Ngày tải lên: 20/06/2014, 21:20

... of E Likewise, essentially the same proof gives the following version of Theorem 1, for r = ∞ Theorem Let X be a paracompact topological space, Y a real Banach space, and A : X → Y ∗ an operator ... topology of E, and taking τ as the weak topology of E Due to the kind of continuity we are assuming for A, the function x → A( x),x turns out to be weakly conti...

Ngày tải lên: 23/06/2014, 00:20

... Cite this article as: Dabaja et al.: Successful treatment of a free-moving abdominal mass with radiation therapy guided by cone-beam computed tomography: a case report Journal of Medical Case Reports ... the conebeam CT scans obtained on selected treatment days and Discussion Accounting for internal organ motion is a major problem in treating abdominal...

Ngày tải lên: 11/08/2014, 02:21

... al.: Assessing the efficacy of a modified assertive community-based treatment programme in a developing country BMC Psychiatry 2010 10:73 Submit your next manuscript to BioMed Central and take ... occupational therapy assessments and coordination of medication issuing One major disadvantage of the teams’ location was the historical, custodial reputation of...

Ngày tải lên: 11/08/2014, 16:22

... universally applicable [43] Gene optimisation has shown promise for a number of infectious diseases For example, ad-based malaria vaccines have been developed containing malarial antigens optimised ... adaptation, optimal for mammalian expression One measure of codon quality is the Codon Adaptation Index (CAI), a measurement for the relative adaptiveness of the codon usa...

Ngày tải lên: 12/08/2014, 04:21