Characterizing evolutionarily conserved influenza a virus sequences as vaccine targets

... multiple strains of influenza A viruses With the availability and easy access to virus sequences in the public databases, as well as the advancement of bioinformatics tools for analysis of large amount ... the availability of seasonal influenza vaccines, their efficacy varies, depending on the match between vaccine strains and the circulating virus strains (Carrat and Flahau...

Ngày tải lên: 03/10/2015, 20:32

... only against linear epitopes but also against conformational epitopes Above described results indicate that eM2 is a valid and versatile vaccine candidate to induce protective immunity against any ... G, Ali M, Wan H, Murakami A, Yammanuru A, Han T, Cox NJ, Bankston LA, Donis RO, Liddington RC, Marasco WA: Structural and functional bases for broad-spectrum neutralization...

Ngày tải lên: 12/08/2014, 02:20

... Modelling gene sequences changes over time in NA gene of 2009 H1N1 emerging strains In order to gain insight into the evolutionary rate and mode of evolution of 2009 H1N1 IAV strains, we used a Bayesian ... paper All authors read and approved the final manuscript Additional material Additional file Origins of the NA sequences from 2009 H1N1 IAV strains A table...

Ngày tải lên: 12/08/2014, 04:21

... 22:477-481 Asanuma H, Aizawa C, Kurata T, Tamura S: IgA antibody- forming cell responses in the nasal-associated lymphoid tissue of mice vaccinated by intranasal, intravenous and/ or subcutaneous administration ... peptide vaccine that contains ectodomains of matrix protein Vaccine 2003, 21:2616-2626 Slepushkin VA, Katz JM, Black RA, Gamble WC, Rota PA, Cox NJ: Protection...

Ngày tải lên: 18/06/2014, 18:20

... samples from allantoic from all NA One-step RT -PCR amplification of NA gene from all NA subtypes using animal samples from allantoic fluids A fragment of approximately 253 bp was amplified using ... representation of 3,337 available sequences in the NCBI database at the time the study was conducted All NA subtypes were aligned against the NA10R primer and a...

Ngày tải lên: 20/06/2014, 01:20

... demonstrates an inhibitory effect against the replication of human influenza A virus H1N1 and H3N2, in vitro and further studies to explore its therapeutic and prophylactic potential against influenza ... respectively Only a handful of drugs are able to inhibit influenza A virus replication and the increasing prevalence of resistance to these drugs demands newe...

Ngày tải lên: 20/06/2014, 01:20

... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can cataly...

Ngày tải lên: 20/06/2014, 01:20

... (H3N2) virus [32] Here we show that the F103L and M106I NS1 gene mutations are adaptive and control IAV replication and virulence Materials and methods Cells and viruses Madin-Darby canine kidney ... study, data acquisition, analysis and interpretation of data as well as drafting the manuscript SW participated in the acquisition, analysis and interpretation of data...

Ngày tải lên: 11/08/2014, 21:21

... to analyse any differences between the PDZ- binding activities of the human and avian NS1 proteins A PDZ array assay had previously been reported, using a large number of isolated PDZ domains, and ... Human (H) NS1, together with the non -PDZ- binding mutant of Avian NS1 (Aa), plus the avian human-like (Ah) and the human avian-like (Ha) mutants Lower panel GS...

Ngày tải lên: 11/08/2014, 21:21

... using gene annotation files and raw data were extracted into MS EXCEL Data Analysis Data was analyzed using GENOWIZ Microarray and Pathway analysis tool (Ocimum Biosolutions, Hyderabad, India) ... this article as: Chakrabarti et al.: Host gene expression profiling in influenza A virus-infected lung epithelial (A5 49) cells: a comparative analysis between...

Ngày tải lên: 12/08/2014, 01:21

... that the NS1 protein of influenza A virus H5N1 was able to induce apoptosis in A5 49 cells Involvement of caspases in NS1- induced apoptosis B C Figure H5N1 NS1 protein induces apoptosis in A5 49 ... cell apoptosis Recently, It has been reported that avian influenza virus A/ HK/483/97 (H5N1) NS1 protein- induced apoptosis in human lung epi...

Ngày tải lên: 12/08/2014, 04:20

... channel activity that is crucial in the entry phase [1] and as a maturation cofactor in virus budding The cytoplasmic tail is implicated in M1 binding and facilitates virus assembly and production ... this manuscript was in preparation Zhou et al reported binding of a cytoplasmic fragment of M2 from human influenza to Cav-1 in an in vitro assay based on a Cav-1 prote...

Ngày tải lên: 12/08/2014, 04:20

... Technology (Danvers, MA, USA), Rabbit monoclonal anti-Flag antibody from Sigma (St Louis, MO, USA), Rabbit monoclonal anti-Akt antibody, Cy3-labeled goat anti-rabbit antibody, peroxidase-conjugated ... viral NS1 protein Virology 2003, 309:181-189 Hayman A, Comely S, Lackenby A, Murphy S, McCauley J, Goodbourn S, Barclay W: Variation in the ability of human influenza A viruses to induce...

Ngày tải lên: 12/08/2014, 04:20

... New York 1987 doi:10.1186/1743-422X-7-174 Cite this article as: Goyal et al.: Isolation of mixed subtypes of influenza A virus from a bald eagle (Haliaeetus leucocephalus) Virology Journal 2010 ... reaction Abbreviations AIV: avian influenza virus; HPAI: highly pathogenic avian influenza virus; LPAI: low pathogenic avian influenza virus; NIH: National Instit...

Ngày tải lên: 12/08/2014, 04:20