Resources and capabilities for two types of servitization contingency on offering nature and serving mode
... literatures, and they are analyzed according to offering nature and serving mode Contingency of requirements on success factors in different types of firms would affect the servitization direction and ... capabilities + Market condition→Motivation to change offering nature or serving mode Figure Hypotheses on Servitization based on Teece's Model Table...
Ngày tải lên: 02/10/2015, 17:14
... that ECOLURE TUBUS is not a suitable pheromone dispenser in comparison with ECOLURE CLASSIC in common forestry conditions ECOLURE TUBUS traps lower the amount of beetles It closely corresponds ... comparison with ECOLURE CLASSIC) and by the end of the season the bag with ECOLURE TUBUS was almost without pheromone The use of ECOLURE TUBUS can be recommended for extreme topolo...
Ngày tải lên: 07/08/2014, 10:22
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: A new paradigm for oxygen binding involving two types of ab contacts docx
... Shikama and A Matsuoka (Eur J Biochem 270) ể FEBS 2003 Fig Schematic diagram of HbA tetramer showing the two dierent types of ab contacts HbA has a molecular dyad axis (which is perpendicular ... experimental data with the aid of a computer As a result, the pH-dependence curves for the autoxidation rate of the separated a and b chains have been analysed completely...
Ngày tải lên: 17/03/2014, 10:20
A study of new and advanced control charts for two categories of time related processes
... mean and range normalization Baxter (1995) applied and studied standardization and transformation in 23 principal component analysis Normalization techniques for microarray data are studied and ... A STUDY OF NEW AND ADVANCED CONTROL CHARTS FOR TWO CATEGORIES OF TIME RELATED PROCESSES DENG PEIPEI B.Sc., University of Science and Technology of Chi...
Ngày tải lên: 10/09/2015, 09:11
Search for new types of deoxyribozymes and development of human topoisomerases inhibitors on the basis of oligonucleotides
... categories of introns and splicing mechanisms These consist of nuclear tRNA introns [66], archaeal introns [67], nuclear mRNA introns [68], and the group I and group II introns [69, 70] Of these introns, ... 10 (denoted as ωG) The second step is initiated by an attack by the 3’-end of the released exon on the 3’ SS, which results in ligation of the exons and re...
Ngày tải lên: 11/09/2015, 16:06
Tài liệu Essay Writing for a Score of 6.0 on the TOEFL and TWE pdf
... - they can learn about responsibility, - they can learn the value of money, - they can learn how to work as a member of a team B Body of the Essay Now you expand on the reasons you gave in the ... paragraph Typically, a TOEFL/ TWE essay will have - body paragraphs C The conclusion: The conclusion will be your final paragraph It will summarize all the main id...
Ngày tải lên: 23/01/2014, 06:20
Báo cáo khoa học: "Thematic segmentation of texts: two methods for two kinds of texts" pdf
... texts both for building the collocation network and for their thematic segmentation /max = log2 N2(Sw - 1) with N: corpus size and Sw: window size Thematic segmentation lexical network without ... vectors Thus, the segmentation process produces a text representation with thematic blocks including paragraphs about the same topic The two methods have been tested on different kind...
Ngày tải lên: 08/03/2014, 05:21
Báo cáo khoa học: "TWO TYPES OF PLANNING IN LANGUAGE GENERATION" pot
... performing certain planning tasks in bottom-up fashion 2.2 A Solution: Interleaving T,Lking this into account, a better solution is to perform limited-commitment planning ~ to defer planning until ... prescriptive planning is uno able to provide adequate control, a different kind of planning is required The limited-commitment planning organization of PAULINE illustrates a po...
Ngày tải lên: 08/03/2014, 18:20
Investigation of au and in as solvents for the growth of silicon nanowires on si(1 1 1)
... insertion of the sample into the UHV chamber in spite of the preceding HF-dip There are hints in the literature [11 ] that deposition of gold onto a thin layer of SiO2 on Si (1 1) favors the decomposition ... melting point (15 7 1C) [13 ] As the surface tension of most liquids decreases in a nearly linear fashion with increasing temperature [14 ], there is...
Ngày tải lên: 16/03/2014, 15:17
Báo cáo hóa học: " An implicit iterative algorithm with errors for two families of generalized asymptotically nonexpansive mappings" pptx
... [21], Thianwan and Suantai [22], Xu and Ori [23], Zhou and Chang [24], we consider the following Ishikawa-like implicit iteration algorithm with errors for two finite families of generalized asymptotically ... et al.: An implicit iterative algorithm with errors for two families of generalized asymptotically nonexpansive mappings Fixed Point Theory...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Cytotoxic effects and the mechanism of three types of magnetic nanoparticles on human hepatoma BEL-7402 cells" ppt
... uptake by human hepatoma BEL-7402 cells The effects of various concentrations (0.05, 0.1, and mg/mL) of the three kinds of MNPs on cell cycle progression and population distribution in BEL-7402 ... al.: Cytotoxic effects and the mechanism of three types of magnetic nanoparticles on human hepatoma BEL-7402 cells Nanoscale Research Lette...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article Solvability for Two Classes of Higher-Order Multi-Point Boundary Value Problems at Resonance" doc
... third-order multi-point boundary value problem at resonance,” Journal of Mathematical Analysis and Applications, vol 302, no 1, pp 217–229, 2005 W Feng and J R L Webb, Solvability of m-point boundary value ... equations,” Journal of Mathematical Analysis and Applications, vol 189, no 2, pp 575–584, 1995 B Liu and J Yu, Solvability of multi-point boundary value prob...
Ngày tải lên: 21/06/2014, 22:20
Báo cáo hóa học: "Research Article Schur-Convexity of Two Types of One-Parameter Mean Values in n Variables" ppt
... permutations and convexset, and has a nonempty interior set Ω0 Let ϕ : Ω → R be continuous on Ω and continuously differentiable in Ω0 Then, ϕ is a Schur-convex (Schur-concave) function if and only ... Shandong Science and Technology Press, Jinan, China, 3rd edition, 2004 [14] D S Mitrinovi´ , Analytic Inequalities, vol 1965 of Die Grundlehren der mathematischen Wisenc schaften, Springer, N...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo khoa học: "Five-year field performance of two types of Douglas fir mini-plug transplants in three forest sites in France" pot
... the establishment in the Netherlands of the European branch of Arborgen, a subsidiary of Weyerhaeuser Company During this period of time, the mini-plug transplanted in different forest nurseries ... tested in the two other sites on on periclymenum) Chemical soil analyses from the upper 30 cm of all three sites were performed in spring 1994 Results are displayed...
Ngày tải lên: 08/08/2014, 14:21