C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription
... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC ......
Ngày tải lên: 01/10/2015, 17:28
C elegans PRDM1 blimp1 homolog BLMP 1 is a positive regulator of bed 3 transcription
... AATC CACAGAATTCAGCTGTACACGGCCT GTTGC CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAATCATTTAATGGAGTT CCAAA CACAAAGCTTAAAAGATTCCCAGAT TTCCAT CACAGCTAGCTCATTTAATGGAGTTC CAAA CACACTCGAGAAAGATTCCCAGATT ... CACATCTAGAAATGGGTCAAGGAAG TGGGGA CACAAAGCTTTTATGGATAATGCGGC AATC CACAGAATTCATGGGTCAAGGAAGT GGGGA CACACTCGAGTGGATAATGCGGCAA TCCGA CACATCTAGAAAGCTGTACACGGCC TGTTGC CACAAAGCTTTTATGGATAATGCGGC AATC ......
Ngày tải lên: 02/10/2015, 12:56
Báo cáo khoa học: Ets-1/ Elk-1 is a critical mediator of dipeptidyl-peptidase III transcription in human glioblastoma cells pdf
... b-actin cDNA was also amplified using primers b-actin F (sense) (5¢-AGAAAATCTGGC ACCACACC-3¢) and b-actin R (antisense) (5¢-TAGCACAGCCTGGATAGCAA-3¢), and served as the internal control Melting-curve ... against Ets-1 raised against its N-terminal region and an antibody against Elk-1 raised against phosphorylated Ser383 present at the C-terminus of this protein Preincubation of nuclear pr...
Ngày tải lên: 29/03/2014, 09:20
The small GTPASE ARF like protein 1 (ARL1) is a new regulator of golgi structure and function
... ClassII: ARF4 , ARF5 Rab ARF Arl Arl1, Arl2, Arl3, Arl4, Arl5, Arl6, Arl7, ARFRP1, ARD1 ClassIII: ARF6 Fig Classification of mammalian ARF famlily small GTPases Ran Sar Sar 1a, Sar1b Fig A schematic ... human ARF3 human ARF3 human ARF4 human ARF4 human ARF5 human ARF5 human ARF6 human ARF6 rat Arl1 rat Arl1 human Arl5 human Arl5 human Arl8 human Arl8 human Arl4 human Arl4...
Ngày tải lên: 17/09/2015, 17:20
Báo cáo khoa học: Insect cytokine, growth-blocking peptide, is a primary regulator of melanin-synthesis enzymes in armyworm larval cuticle pptx
... (L5D2), day last instar (L6D0), and day last instar (L6D1) larvae (Inset) DDC activity in integuments from the same larval stages a* , Significantly different from TH activity of L5D2 larval dorsal integument ... counter (Aloka LSC5100, Tokyo, Japan) Cloning and sequence analysis of TH cDNA Total RNA was isolated from integuments of day last instar larvae using TRIzol reagent (Gib...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Intermittent hypoxia is a key regulator of cancer cell and endothelial cell interplay in tumours pot
... years has led us to consider again this point: can the succession of short hypoxia and reoxygenation phases, typical of intermittent hypoxia, also stabilize HIF- 1a and activate HIF-1? In the absence ... hypoxia in cancer S Toffoli and C Michiels Fig Effects of intermittent hypoxia and chronic hypoxia on HIF- 1a stabilization and HIF-1 target gene transcri...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo y học: "he miR-17-5p microRNA is a key regulator of the G1/S phase cell cycle transition" pdf
... GJ, Hammond SM: A microRNA polycistron as a potential human oncogene Nature 2005, 435:828-833 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa K, Tomida S, Yatabe Y, Kawahara K, Sekido Y, ... HAS2 -A HDAC4 -A HDAC4-B HDAC4-C HDAC4-D HIF1 -A HIF 1A- B IRF1 -A KHDRBS1 -A KHDRBS1-B KPNA2 -A MAP3K8 -A MAP3K8-B MAPK9 -A MYCN -A MYCN-B NCOA3 -A NCOA3-B NCOA3-C NCOA3-D NR...
Ngày tải lên: 14/08/2014, 20:22
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 ... Journal 278 (2 011 ) 11 26 11 36 ª 2 011 The Authors Journal compilation ª 2 011 FEBS 11 31 PTI1-4, a common target of OXI1 and MAPKs C Forzani et al AGC2-3) were also...
Ngày tải lên: 14/02/2014, 19:20
Báo cáo khoa học: Alpha 1-antichymotrypsin/SerpinA3 is a novel target of orphan nuclear receptor Nur77 potx
... pcDNA3.1-GST -Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CG...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo hóa học: " MMP-1 is a (pre-)invasive factor in Barrettassociated esophageal adenocarcinomas and is associated with positive lymph node status" doc
... on MMP-1 and MMP-13 expression, because no data have been available regarding clinicopathological factors in BE and EAC so far Our findings of an increased MMP-1 expression in EAC is well in line ... of MMP-1 in proliferating (Ki-67+) cells of intestinal metaplasia and in Barrett -associated adenocarcinomas may thus sustain multi-step carcinogenesis and further t...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo sinh học: " High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" potx
... primary blasts Haematologica 2008, 93:662-669 34 Sharma SV, Haber DA, Settleman J: Cell < /b> line-based platforms to < /b> evaluate the < /b> therapeutic efficacy of < /b> candidate anticancer agents Nat Rev Cancer < /b> ... Gautschi O, Mack PC, Davies AM, Lara PN, Gandara DR: Aurora < /b> kinase inhibitors: a < /b> new class of < /b> targeted drugs in < /b> cancer < /b> Clin Lung...
Ngày tải lên: 18/06/2014, 22:20
o cáo hóa học:" High Chromosome Number in hematological cancer cell lines is a Negative Predictor of Response to the inhibition of Aurora B and C by GSK1070916" ppt
... inhibitors Conveniently, it is < /b> standard clinical practice to < /b> perform karyotyping on hematological < /b> cancer < /b> cells and chromosome < /b> number < /b> can serve as a < /b> resistance marker for patient response < /b> to < /b> GSK1070916 ... percentage of < /b> polyploidy in < /b> cell < /b> subpopulations For instance, the < /b> karyotype data for the < /b> T...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo y học: "Prostaglandin E2 synthesis in cartilage explants under compression: mPGES-1 is a mechanosensitive gene" docx
... responses in mice lacking an inducible prostaglandin E synthase Proc Natl Acad Sci USA 2003, 100:9044-9049 Kamei D, Yamakawa K, Takegoshi Y, Mikami-Nakanishi M, Nakatani Y, Oh-Ishi S, Yasui H, Azuma Y, ... prostaglandin biosynthesis and metabolism: 15-hydroxyprostaglandin dehydrogenase Prostaglandins Leukot Essent Fatty Acids 2000, 62:1-5 45 Ivanov AI, Romanovsky AA: Prostaglandin E2 a...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: " Peptide P5 (residues 628–683), comprising the entire membrane proximal region of HIV-1 gp41 and its calcium-binding site, is a potent inhibitor of HIV-1 infection" pptx
... molecular biology, biophysical studies and neutralization assays, and drafted the manuscript DT participated to the neutralization and binding assays AA participated in the design of the study and ... P5, and recombinant peptides P5L and P7, at a concentration of 10 μM and in a pH 7.2 buffer, displayed a positive peak after 195 nm and two negative maxima at...
Ngày tải lên: 13/08/2014, 05:21
Claudin 1 is the direct target of RUNX3 in gastric epithelial cells
... Proteins in Mouse 71 Gastric Epithelial Cells 4 .1. 2 TJ Proteins and TGF-β Pathway 73 4 .1. 3 RUNX3 and claudin- 1 in TGF- β Pathway 74 4 .1. 4 claudin- 1 Expression in Mouse Gastric Epithelial Cells ... analysis of claudin- 1 expression 77 upon induction by RUNX3 in SNU16 cell line 4.5 Immunodetection of claudin- 1 in mouse gastric epithelial 7...
Ngày tải lên: 11/09/2015, 09:00