0
  1. Trang chủ >
  2. Ngoại Ngữ >
  3. Tổng hợp >

A taxonomy based perspective of the design trade offs for bittorrent like protocols

A taxonomy based perspective of the design trade offs for bittorrent like protocols

A taxonomy based perspective of the design trade offs for bittorrent like protocols

... propose a new taxonomy- based approach for analyzing the trade- offs in a practical implementation of the BT protocol and investigate these trade- offs in the protocol design space Finally, we propose ... proposed by Fan et al 1.1 Our Approach Therefore, we propose a new taxonomy- based approach for analyzing the trade- offs that takes into consideration the practical implementation of the BT protocol ... that in addition to this ratio, there are many other mechanisms that can affect the trade- offs between performance and fairness that are not captured in their model We believe that because the...
  • 57
  • 261
  • 0
DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical Devices docx

... DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION DESIGN AND DEVELOPMENT OF MEDICAL ELECTRONIC INSTRUMENTATION A Practical Perspective of the Design, Construction, and Test of Medical ... synchronize the inflation and deflation of pressure suits adaptively to gain an increase in the level of gravitational accelerations that an airman is capable of tolerating Additional applications, such as ... however, may not be available in electronic format Library of Congress Cataloging-in-Publication Data: Prutchi, David Design and development of medical electronic instrumentation: a practical perspective...
  • 478
  • 521
  • 2
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control Identifying the protein structural features that account ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I, ... the other components of the MLL1 core complex catalyzes dimethylation of H3K4, we assembled the MLL1 core complex with a catalytically inactive MLL1 SET domain variant, and discovered that the...
  • 11
  • 761
  • 0
 A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc

 A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc

... from the market may also restrict the nature and degree of organizational change or adaptation in organizations (Hannan and Freeman, 1984) Research on organizational change has led to various views ... On the other hand, it is probable that resistance to change may at times have a positive effect on the outcome of organizational change, and that it may be strategically valuable to an organization ... that changes itself but rather the people in the organization that change themselves and thereby change the organization But this leads to the question of whether an organization’s capability to...
  • 249
  • 378
  • 0
A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot

A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot

... List of abbreviations AB Alberta, Canada AHDL Animal Health Diagnostic Laboratory AIA Animal Industry Act AID Animal Industry Division, Michigan Department of Agriculture APHIS-VS Animal and Plant ... welfare of domestic animals in the Animal Industry Act (AIA), P .A 466 of 1988 (AIA 1988) The AIA was “intended to protect the health, safety, and welfare of humans and animals” and consequently addresses ... conduct of the audit; and 4) compilation and analysis of data gathered during the audit and production of the Final Report In addition, each Division appointed an inter-divisional coordinator to...
  • 168
  • 282
  • 1
Báo cáo toán học:

Báo cáo toán học: "A duality based proof of the Combinatorial Nullstellensatz Omran Kouba" pps

... and achieves the proof of Lemma Before proceeding with the proof of Theorem 1, let us recall that the total degree of a polynomial P from K[X1 , , Xm ] is the largest value of d1 + d2 + · · · ... Finally, the conclusion of the theorem follows since m λS11 λS22 · · · λSm P (t1 , t2 , , tm ) = Φ(P ) = t t t (t1 , ,tm )∈S1 ×···×Sm This ends the proof of Theorem References [1] Alon, N., Combinatorial ... combination of the elements of the basis (µt )t∈S This proves the existence of a familly of scalars (λS )t∈S , such that t S ϕm (P ) = t∈S λt µt (P ) for any polynomial P in Km [T ], and achieves the proof...
  • 3
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf

... used AGGAAAAGGCCTTGAAGCTC and TGCTGTATTTGACAGGACAAGTG (outer primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG ... Spectrum-based classification and analysis of the fluorescent images (SKY) was achieved using SkyView™ software (Applied Spectral Imaging, Carlsbad, CA, USA) The karyotypes of every metaphase spread ... carcinoma Ductal carcinoma Breast cancer adenocarcinoma (metastasis pleural effusion) Therapies applied Radiotherapy Chemotherapy months before surgery (CMF) No radiation therapy or chemotherapy before...
  • 17
  • 424
  • 0
a corpus-based analysis of the collocates of the word  homeland  in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ  homeland  qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu

a corpus-based analysis of the collocates of the word homeland in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ homeland qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu

... articles The second and the third group stay the same as the second and the third group in the period of the 1990s In other words, the meaning of the word homeland in the 2000s and 2010s remained the ... that the results for the use of the word homeland collected in Time Magazine corpus be the same as that in COCA Corpus, that is the word homeland in the 2000s and 2010s was almost used as an ... (The collocates of homeland in the highest frequency in the 2000s) It is noteworthy that the use of the word homeland in the 2010s is nearly the same as it was in the 2000s 29 The above table...
  • 40
  • 433
  • 0
A student - based evaluation of the reading comprehension tasks in  Tieng Anh 12 Nang Cao  = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách

A student - based evaluation of the reading comprehension tasks in Tieng Anh 12 Nang Cao = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách

... typical types of the reading tasks in Tieng Anh 12 Nang Cao are as follows Form of task Total: 53 While -reading Task - Matching words and meanings 12 - Question- answering 10 Matching Gap filling ... further macro evaluation On the other hand, micro -evaluation can be an individual, practical and legitimate way of carrying out an empirical evaluation of teaching materials A micro -evaluation of ... 12 Nang Cao at a specific secondary school The next chapter presents an overview of the reading task in Tieng Anh 12 Nang Cao 15 M .A. Thesis CHAPTER OVERVIEW OF THE READING TASK IN TIENG ANH 12...
  • 63
  • 911
  • 0
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

... coefficient of consolidation and end of primary settlement based on a direct solution of the Terzaghi theory This new method determines the coefficient of consolidation utilizing the entire range of consolidation ... study confirms that the identification of the experimental range of primary consolidation that corresponds to the Terzaghi theory is of primary importance for a realistic determination of the coefficient ... ranges from 12% to 66% THE PROPOSED METHOD The actual theoretical one-dimensional consolidation relationship between average degree of consolidation U and the time factor T obtained from the Terzaghi...
  • 9
  • 402
  • 0
A capillary-based method determining the permeability of sand layer for geothermal applications

A capillary-based method determining the permeability of sand layer for geothermal applications

... role in the modelling of the heat transfer of BHEs in an aquifer for geothermal applications This paper presented a novel laboratory method determining the hydraulic permeability of sand layer using ... that, except for sand samples, the present method can also be applied for other porous materials with the grain diameter of 0.1-0.6 mm For porous media with smaller grain diameters, the adaptability ... amount of test samples The present method can provide an important basis for analyzing the heat transfer process of BHEs in a sand- based aquifer, and also be applied for other porous materials with...
  • 8
  • 449
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

... in registers for being filled to gaps found in the rest of the input sentence These registers are too powerful since they enable ATN to recognize the full class of context-sensitive grammars In ... goes out to seek Laay in the cane field and he finds that it is about to walk away.’ The sentence in (17) are split into two SVCs: the series of V1 to V3 and the series of V4 to V5 , because they not ... with the gap There are two constraint parameters in each modality: the combinatory directionality d ∈ {< , >} and the syntactic category c, resulting in the filler and the gap denoted in the forms...
  • 9
  • 572
  • 0
THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS: A Preliminary Assessment pdf

THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS: A Preliminary Assessment pdf

... February 2002 SUMMARY THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS A Preliminary Assessment February 2002 SUMMARY OF FINDINGS • The terror attacks on the World Trade Center, in addition ... recommendations for government action based on our initial research and analysis CHAPTER I AN UNPRECEDENTED ENVIRONMENTAL ASSAULT THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS A Preliminary ... difficult to assess the full reach of the problem Further complicating the task of assessing environmental impacts of the World Trade Center attacks are questions about the city’s air quality monitoring...
  • 35
  • 361
  • 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand A (Y9) and the last amino acid of strand ... molecular dynamics (SMD) simulations have shown that for I27 rupture of a pair of hydrogen bonds in the A and B b-strands near the amino terminus of the protein domain causes an initial extension of...
  • 12
  • 553
  • 0
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

... Mag Stephan FRIEDRICH A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL A technological, economic and ecological investigation based on case studies SCHRIFTENREIHE ... to the connected database thus eliminating the need for data entry Administration of the questionnaire online offered several advantages over a paperand-pencil administration First, responses automatically ... Ottawa 2002, p 85, via e-mail to the author 23 FRIEDRICH 2.5314 Biodiesel: Basic facts Scenario analysis: optimum plant size and location An economic comparison was calculated by CONNEMANN and...
  • 164
  • 601
  • 3

Xem thêm

Từ khóa: Báo cáo quy trình mua hàng CT CP Công Nghệ NPVchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ